Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101339236:

Variant ID: vg0101339236 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 1339236
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTGAGACCAATAGCAGAGCTGAACCGTGGATAGATAAGAACACATGACCGCCTTCCGTTGCCACACACACGCATATATCGTACCCCTCAATTTCAAAA[T/C]
GTTTGACACCGTTGACATTTTAGCACATGTTTAACCGTTCGTCTTATTCAATTTTTTTTGTGAAATATGTAAAACTATATGTGTATATGAAAATATATTT

Reverse complement sequence

AAATATATTTTCATATACACATATAGTTTTACATATTTCACAAAAAAAATTGAATAAGACGAACGGTTAAACATGTGCTAAAATGTCAACGGTGTCAAAC[A/G]
TTTTGAAATTGAGGGGTACGATATATGCGTGTGTGTGGCAACGGAAGGCGGTCATGTGTTCTTATCTATCCACGGTTCAGCTCTGCTATTGGTCTCAGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.90%	18.70%	0.34%	8.04%	NA
All Indica	2759	68.40%	28.30%	0.18%	3.15%	NA
All Japonica	1512	91.10%	6.10%	0.00%	2.78%	NA
Aus	269	11.50%	1.90%	3.35%	83.27%	NA
Indica I	595	70.60%	28.20%	0.17%	1.01%	NA
Indica II	465	94.40%	5.20%	0.00%	0.43%	NA
Indica III	913	55.80%	41.10%	0.00%	3.18%	NA
Indica Intermediate	786	65.90%	27.20%	0.51%	6.36%	NA
Temperate Japonica	767	87.70%	11.60%	0.00%	0.65%	NA
Tropical Japonica	504	98.60%	0.40%	0.00%	0.99%	NA
Japonica Intermediate	241	86.30%	0.40%	0.00%	13.28%	NA
VI/Aromatic	96	80.20%	2.10%	2.08%	15.62%	NA
Intermediate	90	80.00%	6.70%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0101339236	T -> DEL	N	N	silent_mutation	Average:85.728; most accessible tissue: Minghui63 flag leaf, score: 97.474	N	N	N	N
vg0101339236	T -> C	LOC_Os01g03290.1	upstream_gene_variant ; 4497.0bp to feature; MODIFIER	silent_mutation	Average:85.728; most accessible tissue: Minghui63 flag leaf, score: 97.474	N	N	N	N
vg0101339236	T -> C	LOC_Os01g03310.1	upstream_gene_variant ; 97.0bp to feature; MODIFIER	silent_mutation	Average:85.728; most accessible tissue: Minghui63 flag leaf, score: 97.474	N	N	N	N
vg0101339236	T -> C	LOC_Os01g03300.1	downstream_gene_variant ; 1829.0bp to feature; MODIFIER	silent_mutation	Average:85.728; most accessible tissue: Minghui63 flag leaf, score: 97.474	N	N	N	N
vg0101339236	T -> C	LOC_Os01g03320.1	downstream_gene_variant ; 2083.0bp to feature; MODIFIER	silent_mutation	Average:85.728; most accessible tissue: Minghui63 flag leaf, score: 97.474	N	N	N	N
vg0101339236	T -> C	LOC_Os01g03310-LOC_Os01g03320	intergenic_region ; MODIFIER	silent_mutation	Average:85.728; most accessible tissue: Minghui63 flag leaf, score: 97.474	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0101339236	T	C	-0.04	0.02	0.04	0.0	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0101339236	NA	6.36E-06	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	NA	9.81E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	NA	7.41E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	NA	3.10E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	NA	1.91E-09	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	1.42E-06	1.02E-11	mr1728	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	1.89E-06	5.12E-08	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	NA	3.50E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	NA	4.76E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101339236	NA	9.52E-06	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251