Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101041880:

Variant ID: vg0101041880 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1041880
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTTACACTGAAAAAGAAAGAAAATGCATTCAGAATAATGTTGCTGTTAATTTATTTTTTTCTTAGCCTTTTCCCCTGGCATCTCCGTGTGTAGGGCCC[C/G]
ACTTCCTGGGGTCTTCAACTCTATTCATTGACTTGATTGACTGAACATTGTCTCCTTATGGTGGAACTTTCAAAAAGAAAAGGAAAAAACACTGTGAATG

Reverse complement sequence

CATTCACAGTGTTTTTTCCTTTTCTTTTTGAAAGTTCCACCATAAGGAGACAATGTTCAGTCAATCAAGTCAATGAATAGAGTTGAAGACCCCAGGAAGT[G/C]
GGGCCCTACACACGGAGATGCCAGGGGAAAAGGCTAAGAAAAAAATAAATTAACAGCAACATTATTCTGAATGCATTTTCTTTCTTTTTCAGTGTAACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 27.60% 0.00% 0.00% NA
All Indica  2759 61.70% 38.30% 0.00% 0.00% NA
All Japonica  1512 98.60% 1.40% 0.00% 0.00% NA
Aus  269 32.00% 68.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 29.90% 70.10% 0.00% 0.00% NA
Indica III  913 56.40% 43.60% 0.00% 0.00% NA
Indica Intermediate  786 58.80% 41.20% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101041880 C -> G LOC_Os01g02890.1 upstream_gene_variant ; 4724.0bp to feature; MODIFIER silent_mutation Average:58.565; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0101041880 C -> G LOC_Os01g02884-LOC_Os01g02890 intergenic_region ; MODIFIER silent_mutation Average:58.565; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0101041880 C G -0.07 -0.04 -0.04 -0.12 -0.16 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101041880 NA 2.44E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 1.99E-08 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 8.26E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 1.28E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 5.76E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 9.95E-09 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 2.63E-08 mr1333 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 1.12E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 6.24E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 6.34E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 3.02E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 1.23E-07 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 5.10E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 1.80E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 5.92E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 3.29E-07 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101041880 NA 4.82E-08 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251