Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100300455:

Variant ID: vg0100300455 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 300455
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGTTGCTTACTATACTATTAATACCTGGTCCTACCTGTCATACACACATTACGTCTTGGAGTCCGTGCTGCAGCTGACTACAGATGTATAGCCCGCTG[C/T]
TCTTCTCTCTCTTCCTTTATCTCTTTAAAATATGGTTATAGCTGGCTTATAGCCTGCTATTGTACCTGCTCTAATATAGCATCTGCCCATACATACACAC

Reverse complement sequence

GTGTGTATGTATGGGCAGATGCTATATTAGAGCAGGTACAATAGCAGGCTATAAGCCAGCTATAACCATATTTTAAAGAGATAAAGGAAGAGAGAGAAGA[G/A]
CAGCGGGCTATACATCTGTAGTCAGCTGCAGCACGGACTCCAAGACGTAATGTGTGTATGACAGGTAGGACCAGGTATTAATAGTATAGTAAGCAACTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 38.50% 0.44% 5.54% NA
All Indica  2759 36.60% 61.60% 0.40% 1.45% NA
All Japonica  1512 93.50% 6.30% 0.07% 0.07% NA
Aus  269 26.40% 0.40% 2.23% 71.00% NA
Indica I  595 2.20% 97.50% 0.34% 0.00% NA
Indica II  465 35.10% 64.50% 0.43% 0.00% NA
Indica III  913 58.60% 40.00% 0.33% 1.10% NA
Indica Intermediate  786 37.90% 57.80% 0.51% 3.82% NA
Temperate Japonica  767 87.50% 12.40% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 75.00% 2.10% 2.08% 20.83% NA
Intermediate  90 63.30% 24.40% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100300455 C -> T LOC_Os01g01600.1 upstream_gene_variant ; 2648.0bp to feature; MODIFIER silent_mutation Average:75.137; most accessible tissue: Zhenshan97 panicle, score: 97.957 N N N N
vg0100300455 C -> T LOC_Os01g01590-LOC_Os01g01600 intergenic_region ; MODIFIER silent_mutation Average:75.137; most accessible tissue: Zhenshan97 panicle, score: 97.957 N N N N
vg0100300455 C -> DEL N N silent_mutation Average:75.137; most accessible tissue: Zhenshan97 panicle, score: 97.957 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0100300455 C T -0.02 -0.04 -0.02 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100300455 NA 6.78E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100300455 NA 1.24E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100300455 4.74E-06 NA mr1873 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100300455 NA 5.83E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251