Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100068121:

Variant ID: vg0100068121 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 68121
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.16, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGTTAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAAATAGAAACAAACAGATCGCGGTTAAATCTATAAATGATAGCCGATCGGCTAAGTGCC[G/A]
ATGACATATCATTTATCTTTGAGCCGATGTCATATGTGAATTGATCGGCGACTATAAATAGATAATAAAGAACTAAACCTACTCGATCGGCTGTAGATAT

Reverse complement sequence

ATATCTACAGCCGATCGAGTAGGTTTAGTTCTTTATTATCTATTTATAGTCGCCGATCAATTCACATATGACATCGGCTCAAAGATAAATGATATGTCAT[C/T]
GGCACTTAGCCGATCGGCTATCATTTATAGATTTAACCGCGATCTGTTTGTTTCTATTTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTAACACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.80%	22.60%	0.15%	0.47%	NA
All Indica	2759	70.80%	28.20%	0.22%	0.80%	NA
All Japonica	1512	97.60%	2.40%	0.00%	0.00%	NA
Aus	269	17.50%	82.50%	0.00%	0.00%	NA
Indica I	595	29.70%	68.70%	0.50%	1.01%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	87.00%	11.80%	0.11%	1.10%	NA
Indica Intermediate	786	67.90%	31.00%	0.25%	0.76%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	93.80%	6.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0100068121	G -> A	LOC_Os01g01130.1	upstream_gene_variant ; 1819.0bp to feature; MODIFIER	silent_mutation	Average:36.385; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0100068121	G -> A	LOC_Os01g01140.1	upstream_gene_variant ; 1554.0bp to feature; MODIFIER	silent_mutation	Average:36.385; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0100068121	G -> A	LOC_Os01g01150.1	upstream_gene_variant ; 4654.0bp to feature; MODIFIER	silent_mutation	Average:36.385; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0100068121	G -> A	LOC_Os01g01150.2	upstream_gene_variant ; 4654.0bp to feature; MODIFIER	silent_mutation	Average:36.385; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0100068121	G -> A	LOC_Os01g01150.3	upstream_gene_variant ; 4654.0bp to feature; MODIFIER	silent_mutation	Average:36.385; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0100068121	G -> A	LOC_Os01g01120.1	downstream_gene_variant ; 4545.0bp to feature; MODIFIER	silent_mutation	Average:36.385; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0100068121	G -> A	LOC_Os01g01130-LOC_Os01g01140	intergenic_region ; MODIFIER	silent_mutation	Average:36.385; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0100068121	G -> DEL	N	N	silent_mutation	Average:36.385; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0100068121	NA	1.23E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121	1.95E-06	NA	mr1047_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121	NA	7.16E-06	mr1047_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121	NA	8.60E-06	mr1189_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121	NA	3.56E-07	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121	NA	8.91E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121	NA	1.30E-07	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121	NA	4.46E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251