11 variations found. LOC_Os12g42540 (zinc finger; C3HC4 type domain containing protein; expressed), ranging from 26,424,869 bp to 26,425,124 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg1226424870 (J) | chr12 | 26424870 | A | G | 71.50% | 16.44% | A -> G | NA |
LOC_Os12g42540.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g42540.1 Alt: G| start_lost HIGH(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 92.807; most accessible tissue: Minghui63 flag leaf, score: 99.018 |
| vg1226424874 (J) | chr12 | 26424874 | T | C | 73.00% | 15.64% | T -> C | NA |
LOC_Os12g42540.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
LOC_Os12g42540.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 92.880; most accessible tissue: Minghui63 flag leaf, score: 99.020 |
| vg1226424883 (J) | chr12 | 26424883 | C | T | 94.30% | 1.06% | C -> T | NA |
LOC_Os12g42540.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g42540.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 92.998; most accessible tissue: Minghui63 flag leaf, score: 99.073 |
| vg1226424949 (J) | chr12 | 26424949 | C | CGGCGAC GGCGGCG GT | 98.90% | 0.00% | C -> CGGCGACGGC GGCGGT,T | NA |
LOC_Os12g42540.1 Alt: CGGCGACGGCGGCGGT| inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os12g42540.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 95.935; most accessible tissue: Minghui63 flag leaf, score: 99.322 |
| vg1226424989 (J) | chr12 | 26424989 | C | T | 71.20% | 0.21% | C -> T | NA |
LOC_Os12g42540.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g42540.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 95.513; most accessible tissue: Minghui63 flag leaf, score: 99.154 |
| vg1226424993 (J) | chr12 | 26424993 | G | A | 98.90% | 0.00% | G -> A | NA |
LOC_Os12g42540.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 95.503; most accessible tissue: Minghui63 flag leaf, score: 99.143 |
| vg1226425014 (J) | chr12 | 26425014 | T | C | 70.70% | 0.00% | T -> C | NA |
LOC_Os12g42540.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 95.198; most accessible tissue: Minghui63 flag leaf, score: 98.990 |
| vg1226425037 (J) | chr12 | 26425037 | C | T | 93.40% | 0.00% | C -> T | NA |
LOC_Os12g42540.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 95.068; most accessible tissue: Minghui63 flag leaf, score: 98.880 |
| vg1226425095 (J) | chr12 | 26425095 | T | TCGCCGC CGCCGGC GGCGCCG CCGGCGC | 99.10% | 0.00% | T -> TCGCCGCCGC CGGCGGCGCC GCCGGCGC | NA |
LOC_Os12g42540.1 Alt: TCGCCGCCGCCGGCGGCGCCGCCGGCGC| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
The average chromatin accessibility score: 93.911; most accessible tissue: Minghui63 flag leaf, score: 98.813 |
| vg1226425112 (J) | chr12 | 26425112 | C | A | 99.60% | 0.00% | C -> A | NA |
LOC_Os12g42540.1 Alt: A| synonymous_variant LOW(snpEff)
LOC_Os12g42530.1 Alt: A| downstream_gene_variant MODIFIER(snpEff) LOC_Os12g42550.1 Alt: A| downstream_gene_variant MODIFIER(snpEff) LOC_Os12g42550.2 Alt: A| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 94.052; most accessible tissue: Minghui63 flag leaf, score: 98.847 |
| vg1226425118 (J) | chr12 | 26425118 | A | G | 80.10% | 11.43% | A -> G | NA |
LOC_Os12g42540.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g42540.1 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 94.101; most accessible tissue: Minghui63 flag leaf, score: 98.883 |