14 variations found. LOC_Os12g04090 (zinc finger; C3HC4 type domain containing protein), ranging from 1,715,126 bp to 1,715,745 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg1201715212 (J) | chr12 | 1715212 | C | A | 64.50% | 0.00% | A -> C |
mr1082 (All); LR P-value: 1.91E-38;
mr1148 (All); LR P-value: 5.02E-27; mr1256 (All); LR P-value: 8.08E-29; mr1414 (All); LR P-value: 3.93E-27; mr1645 (All); LR P-value: 5.35E-39; mr1922 (All); LR P-value: 2.93E-28; mr1082_2 (All); LR P-value: 4.52E-36; mr1085_2 (All); LR P-value: 6.22E-32; mr1238_2 (All); LR P-value: 1.55E-28; mr1264_2 (All); LR P-value: 4.81E-39; mr1342_2 (All); LR P-value: 1.11E-16; mr1403_2 (All); LR P-value: 7.90E-26; mr1484_2 (All); LR P-value: 1.67E-24; mr1609_2 (All); LR P-value: 2.41E-22; mr1841_2 (All); LR P-value: 7.56E-33; mr1900_2 (All); LR P-value: 2.16E-21; mr1915_2 (All); LR P-value: 3.19E-06 |
LOC_Os12g04090.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 77.372; most accessible tissue: Callus, score: 87.880 |
| vg1201715448 (J) | chr12 | 1715448 | A | AT | 99.70% | 0.00% | A -> AT | NA |
LOC_Os12g04080.1 Alt: AT| upstream_gene_variant MODIFIER(snpEff)
LOC_Os12g04100.1 Alt: AT| upstream_gene_variant MODIFIER(snpEff) LOC_Os12g04060.1 Alt: AT| downstream_gene_variant MODIFIER(snpEff) LOC_Os12g04070.1 Alt: AT| downstream_gene_variant MODIFIER(snpEff) LOC_Os12g04110.1 Alt: AT| downstream_gene_variant MODIFIER(snpEff) LOC_Os12g04090.1 Alt: AT| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 76.956; most accessible tissue: Callus, score: 91.310 |
| vg1201715450 (J) | chr12 | 1715450 | T | C | 56.90% | 0.00% | C -> T |
mr1063 (All); LR P-value: 3.61E-48;
mr1083 (All); LR P-value: 6.50E-23; mr1088 (All); LR P-value: 4.64E-59; mr1108 (All); LR P-value: 6.23E-44; mr1145 (All); LR P-value: 1.21E-28; mr1189 (All); LR P-value: 7.82E-06; mr1199 (All); LR P-value: 5.81E-15; mr1224 (All); LR P-value: 2.96E-31; mr1225 (All); LR P-value: 1.11E-31; mr1226 (All); LR P-value: 2.82E-29; mr1233 (All); LR P-value: 1.01E-11; mr1237 (All); LR P-value: 2.66E-29; mr1246 (All); LR P-value: 9.75E-65; mr1264 (All); LR P-value: 4.02E-24; mr1342 (All); LR P-value: 3.57E-09; mr1436 (All); LR P-value: 1.68E-29; mr1560 (All); LR P-value: 2.64E-30; mr1796 (All); LR P-value: 1.56E-06; mr1878 (All); LR P-value: 3.10E-32; mr1047_2 (All); LR P-value: 8.71E-11; mr1083_2 (All); LR P-value: 6.30E-32; mr1088_2 (All); LR P-value: 6.92E-77; mr1112_2 (All); LR P-value: 3.86E-62; mr1121_2 (All); LR P-value: 1.30E-51; mr1147_2 (All); LR P-value: 1.46E-12; mr1189_2 (All); LR P-value: 3.91E-14; mr1199_2 (All); LR P-value: 1.03E-17; mr1208_2 (All); LR P-value: 2.75E-36; mr1224_2 (All); LR P-value: 7.57E-38; mr1246_2 (All); LR P-value: 1.46E-80; mr1264_2 (All); LR P-value: 5.03E-39; mr1270_2 (All); LR P-value: 8.93E-29; mr1316_2 (All); LR P-value: 4.84E-22; mr1325_2 (All); LR P-value: 9.41E-13; mr1404_2 (All); LR P-value: 2.53E-51; mr1623_2 (All); LR P-value: 2.75E-07; mr1690_2 (All); LR P-value: 7.28E-08; mr1734_2 (All); LR P-value: 2.92E-12; mr1744_2 (All); LR P-value: 9.78E-17; mr1782_2 (All); LR P-value: 5.79E-12; mr1834_2 (All); LR P-value: 6.50E-07; mr1878_2 (All); LR P-value: 2.78E-35 |
LOC_Os12g04080.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os12g04100.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os12g04060.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os12g04070.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os12g04110.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os12g04090.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 76.776; most accessible tissue: Callus, score: 91.310 |
| vg1201715494 (J) | chr12 | 1715494 | CCGA | C | 44.60% | 52.09% | CCGA -> C | NA |
LOC_Os12g04090.1 Alt: C| inframe_deletion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 71.118; most accessible tissue: Callus, score: 91.310 |
| vg1201715495 (J) | chr12 | 1715495 | C | CGGT | 45.90% | 36.20% | C -> CGGT | NA |
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: CGGT| inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar) The average chromatin accessibility score: 70.890; most accessible tissue: Callus, score: 91.310 |
| vg1201715496 (J) | chr12 | 1715496 | G | GGTGATG GTCGTGG TGGTGAT | 46.10% | 44.20% | G -> GGTGATGGTC GTGGTGGTGA T,GGTGATGG TCGTGGTGGT GATATCGTCG TCCTC | NA |
LOC_Os12g04090.1 Alt: GGTGATGGTCGTGGTGGTGATATCGTCGTCCTC| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar) LOC_Os12g04090.1 Alt: GGTGATGGTCGTGGTGGTGAT| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar) The average chromatin accessibility score: 70.833; most accessible tissue: Callus, score: 91.310 |
| vg1201715497 (J) | chr12 | 1715497 | A | ATGGTCG TGGTGGT GATATCG T | 45.00% | 35.61% | A -> ATGGT,ATGG TCGTGGTGGT GATAT,ATGG TCGTGGTGGT GATATCGT,A TGGTCGTGGT GGTGATATCG TCGTGCT | NA |
LOC_Os12g04090.1 Alt: ATGGT| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: ATGGTCGTGGTGGTGATAT| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar) LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar) LOC_Os12g04090.1 Alt: ATGGTCGTGGTGGTGATATCGT| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar) LOC_Os12g04090.1 Alt: ATGGTCGTGGTGGTGATATCGTCGTGCT| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar) The average chromatin accessibility score: 70.894; most accessible tissue: Callus, score: 91.310 |
| vg1201715499 (J) | chr12 | 1715499 | G | GT | 44.50% | 49.79% | G -> GT | NA |
LOC_Os12g04090.1 Alt: GT| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 70.815; most accessible tissue: Callus, score: 91.310 |
| vg1201715500 (J) | chr12 | 1715500 | G | T | 43.60% | 54.61% | G -> T | NA |
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 70.815; most accessible tissue: Callus, score: 91.310 |
| vg1201715501 (J) | chr12 | 1715501 | G | T | 43.50% | 50.95% | G -> GTGGT,T | NA |
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) LOC_Os12g04090.1 Alt: GTGGT| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar) The average chromatin accessibility score: 70.728; most accessible tissue: Callus, score: 91.310 |
| vg1201715506 (J) | chr12 | 1715506 | C | G | 43.50% | 54.76% | C -> G | NA |
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: G| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 70.261; most accessible tissue: Callus, score: 91.310 |
| vg1201715507 (J) | chr12 | 1715507 | C | T | 43.50% | 54.76% | C -> T | NA |
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 70.261; most accessible tissue: Callus, score: 91.310 |
| vg1201715563 (J) | chr12 | 1715563 | G | C | 44.40% | 53.83% | G -> C | NA |
LOC_Os12g04090.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 63.904; most accessible tissue: Callus, score: 91.310 |
| vg1201715730 (J) | chr12 | 1715730 | G | A | 44.40% | 53.17% | G -> A | NA |
LOC_Os12g04090.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os12g04090.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 13.021; most accessible tissue: Callus, score: 87.737 |