24 variations found. LOC_Os06g25580 (transposon protein; putative; unclassified; expressed), ranging from 14,959,944 bp to 14,965,966 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg0614961169 (J) | chr06 | 14961169 | C | T | 27.20% | 65.13% | C -> T | NA |
LOC_Os06g25580.1 Alt: T| splice_region_variant&intron_variant LOW(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614961191 (J) | chr06 | 14961191 | G | A | 25.10% | 62.08% | G -> A | NA |
LOC_Os06g25580.1 Alt: A/stop_gained(CooVar)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 4.497; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614961452 (J) | chr06 | 14961452 | G | A | 23.20% | 53.03% | G -> A | NA |
LOC_Os06g25580.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 5.508; most accessible tissue: Callus, score: 15.921 |
| vg0614961483 (J) | chr06 | 14961483 | T | A | 46.90% | 12.63% | T -> A | NA |
LOC_Os06g25580.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 5.508; most accessible tissue: Callus, score: 15.921 |
| vg0614961729 (J) | chr06 | 14961729 | G | C | 38.90% | 32.27% | G -> C | NA |
LOC_Os06g25580.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 5.437; most accessible tissue: Callus, score: 15.135 |
| vg0614961730 (J) | chr06 | 14961730 | G | T | 38.60% | 32.44% | G -> T | NA |
LOC_Os06g25580.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 5.437; most accessible tissue: Callus, score: 15.135 |
| vg0614962408 (J) | chr06 | 14962408 | C | T | 24.80% | 66.67% | C -> T | NA |
LOC_Os06g25580.1 Alt: T/splice_donor_variant(CooVar)
LOC_Os06g25580.1 Alt: DEL/splice_donor_variant(CooVar) The average chromatin accessibility score: 4.210; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614962467 (J) | chr06 | 14962467 | G | T | 35.70% | 60.79% | G -> T | NA |
LOC_Os06g25580.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 4.786; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614962488 (J) | chr06 | 14962488 | A | T | 35.80% | 60.52% | A -> T | NA |
LOC_Os06g25580.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 4.786; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614962529 (J) | chr06 | 14962529 | CCACCCA AAAACAC CG | C | 35.70% | 60.66% | CCACCCAAAA ACACCG -> C,CTGTGTGC GTCTCACCCA AAAACACCG | NA |
LOC_Os06g25580.1 Alt: CTGTGTGCGTCTCACCCAAAAACACCG| frameshift_variant&stop_gained HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) LOC_Os06g25580.1 Alt: C/inframe_variant(CooVar) The average chromatin accessibility score: 4.869; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614962545 (J) | chr06 | 14962545 | TCGACGG GACCAAC TGGTGCT CCCGCCA GCGGTAG CCCGAGC AGGTACG ACACGTC CTGCAGT GTCGGAG CCATCTC CCCACAG GGAAGGT GGAAC | T | 35.60% | 60.77% | TCGACGGGAC CAACTGGTGC TCCCGCCAGC GGTAGCCCGA GCAGGTACGA CACGTCCTGC AGTGTCGGAG CCATCTCCCC ACAGGGAAGG TGGAAC -> T | NA |
LOC_Os06g25580.1 Alt: T/frameshift_variant(CooVar)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 4.869; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614962571 (J) | chr06 | 14962571 | C | T | 33.50% | 61.02% | C -> T | NA |
LOC_Os06g25580.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 4.869; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614962658 (J) | chr06 | 14962658 | C | T | 38.50% | 54.10% | C -> T | NA |
LOC_Os06g25580.1 Alt: T/stop_gained(CooVar)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 4.869; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614962751 (J) | chr06 | 14962751 | A | C | 31.30% | 61.49% | A -> C | NA |
LOC_Os06g25580.1 Alt: C| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 5.289; most accessible tissue: Zhenshan97 young leaf, score: 8.295 |
| vg0614962830 (J) | chr06 | 14962830 | G | C | 32.00% | 61.05% | G -> C | NA |
LOC_Os06g25580.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 5.183; most accessible tissue: Zhenshan97 young leaf, score: 7.417 |
| vg0614962976 (J) | chr06 | 14962976 | G | A | 35.30% | 60.73% | G -> A | NA |
LOC_Os06g25580.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 5.104; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614962984 (J) | chr06 | 14962984 | G | A | 34.30% | 61.21% | G -> A | NA |
LOC_Os06g25580.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 5.104; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614963067 (J) | chr06 | 14963067 | A | T | 29.90% | 61.98% | A -> T | NA |
LOC_Os06g25580.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 5.104; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614963104 (J) | chr06 | 14963104 | A | G | 29.00% | 58.51% | A -> G | NA |
LOC_Os06g25580.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 4.835; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614963112 (J) | chr06 | 14963112 | A | G | 29.30% | 58.38% | A -> G | NA |
LOC_Os06g25580.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 4.835; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614963175 (J) | chr06 | 14963175 | G | C | 35.10% | 60.83% | G -> C | NA |
LOC_Os06g25580.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 4.663; most accessible tissue: Minghui63 panicle, score: 7.125 |
| vg0614964953 (J) | chr06 | 14964953 | T | G | 0.50% | 83.43% | G -> T | NA |
LOC_Os06g25580.1 Alt: T| synonymous_variant LOW(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 11.936; most accessible tissue: Minghui63 young leaf, score: 23.613 |
| vg0614964955 (J) | chr06 | 14964955 | A | T | 0.50% | 92.07% | T -> A | NA |
LOC_Os06g25580.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 11.936; most accessible tissue: Minghui63 young leaf, score: 23.613 |
| vg0614964956 (J) | chr06 | 14964956 | A | T | 0.50% | 89.48% | T -> A | NA |
LOC_Os06g25580.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os06g25580.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 11.936; most accessible tissue: Minghui63 young leaf, score: 23.613 |