Search for Variation by Gene:

Gene ID/Symbol/Name (e.g., LOC_Os01g08570 or hwh1 or Os01g0180900 or gly%ltransferase, note: wildcard character '%' is also acceptable.):
Upstream (kb, optional, must <= 10 kb) : Downstream (kb, optional, must <= 10 kb) :
Variations Type:

Optional: (The selected data will be displayed in the result page.)
 Show Gene Expression Atlas  Show Chromatin Accessibility Map
 Show Non-coding variation Scores

Search Results:

11 variations found. LOC_Os02g57440 (LYK8; putative; expressed), ranging from 35,205,010 bp to 35,206,285 bp (including 0 kb upstream and 0 kb downstream of the gene).

Variation Map (with Chromatin Accessibility Map/ Non-coding Varation Scores Map) in Searched Region:

The 'big effect' variations are marked out:

ColorExplainDetails
red High impact variants defined by snpEff 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff.
purple 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here.

Detailed Variation Information:

Var ID Chrom Position Primary Allele Secondary Allele Primary Allele Frequency DEL Frequency Var GWAS Results Effect
vg0235205068 (J) chr02 35205068 AAGG GAGG 98.10% 0.00% AAGG -> GAGG,A NA
LOC_Os02g57440.1 Alt: GAGG| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
LOC_Os02g57440.1 Alt: A| inframe_deletion MODERATE(snpEff)/inframe_variant(CooVar)
The average chromatin accessibility score: 96.128; most accessible tissue: Minghui63 root, score: 97.666
vg0235205112 (J) chr02 35205112 C A 98.30% 0.00% C -> A NA
LOC_Os02g57440.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 93.341; most accessible tissue: Minghui63 root, score: 97.300
vg0235205164 (J) chr02 35205164 AAGCATC AGCATCA GCATC AAGCATC 43.40% 0.00% AAGCATC -> AAGCATCAGC ATCAGCATC, AAGCATCAGC ATC,A,AAGC ATCAGCATCA GCATCAGCAT C NA
LOC_Os02g57440.1 Alt: A| disruptive_inframe_deletion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os02g57440.1 Alt: AAGCATCAGCATCAGCATC| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os02g57440.1 Alt: AAGCATCAGCATC| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os02g57440.1 Alt: AAGCATCAGCATCAGCATCAGCATC| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
The average chromatin accessibility score: 92.562; most accessible tissue: Minghui63 root, score: 96.361
vg0235205205 (J) chr02 35205205 G A 75.90% 0.00% A -> G
mr1448 (All); LR P-value: 2.57E-33;
mr1448 (Jap_All); LR P-value: 3.92E-06;
mr1526_2 (Jap_All); LR P-value: 2.82E-09;
mr1798_2 (Jap_All); LR P-value: 8.38E-08
LOC_Os02g57440.1 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 93.877; most accessible tissue: Minghui63 flag leaf, score: 96.501
vg0235205234 (J) chr02 35205234 C T 99.30% 0.00% C -> T NA
LOC_Os02g57440.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 93.751; most accessible tissue: Minghui63 flag leaf, score: 96.400
vg0235205544 (J) chr02 35205544 C T 98.40% 0.00% C -> T NA
LOC_Os02g57440.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 92.004; most accessible tissue: Zhenshan97 flag leaf, score: 96.276
vg0235205760 (J) chr02 35205760 C T 99.80% 0.00% C -> T NA
LOC_Os02g57440.1 Alt: T| synonymous_variant LOW(snpEff)
LOC_Os02g57430.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)
LOC_Os02g57450.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)
LOC_Os02g57450.2 Alt: T| downstream_gene_variant MODIFIER(snpEff)
The average chromatin accessibility score: 91.345; most accessible tissue: Zhenshan97 flag leaf, score: 96.040
vg0235205805 (J) chr02 35205805 C T 98.30% 0.00% C -> T NA
LOC_Os02g57440.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 91.828; most accessible tissue: Zhenshan97 flag leaf, score: 96.587
vg0235205858 (J) chr02 35205858 C T 99.50% 0.00% C -> T NA
LOC_Os02g57440.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
The average chromatin accessibility score: 89.583; most accessible tissue: Zhenshan97 flag leaf, score: 96.674
vg0235205886 (J) chr02 35205886 T C 75.90% 0.00% C -> T
mr1188 (All); LMM P-value: 6.61E-06;
mr1448 (All); LR P-value: 2.84E-32;
mr1667 (All); LR P-value: 9.34E-12;
mr1526_2 (Jap_All); LR P-value: 2.55E-08;
mr1798_2 (Jap_All); LR P-value: 2.50E-07
LOC_Os02g57440.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 89.745; most accessible tissue: Zhenshan97 flag leaf, score: 96.777
vg0235206237 (J) chr02 35206237 T C 81.50% 0.00% T -> C
mr1045 (Ind_All); LR P-value: 3.54E-06;
mr1352 (Ind_All); LR P-value: 3.33E-07;
mr1602 (All); LR P-value: 4.81E-06;
mr1823_2 (Ind_All); LR P-value: 2.44E-06;
mr1824_2 (Ind_All); LR P-value: 2.07E-06;
mr1894_2 (Ind_All); LR P-value: 5.30E-06
LOC_Os02g57440.1 Alt: C| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 95.414; most accessible tissue: Minghui63 root, score: 96.634