\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227173062:

Variant ID: vg1227173062 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 27173062
Reference Allele: AAlternative Allele: T,ATCT,ATCTTCT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CCAACTCCCTACTTCTTCTACTCCTCGTCTTCGTTCGTCTTCGTCTTCTTGTACAATTAATTCCTCCTCTTTCTCCGCCCAAGAAACCCACACCAAAAAC[A/T,ATCT,ATCTTCT]
TCTTCTTCTTCTTCTCCGTGTCAAAACAAACACTGTTTCTCTCTCTCTCTCTCTCTCTCTCTTTCTCTGTGTTCAGAGCCAAGAAGTCTCTGCTCTGCAT

Reverse complement sequence

ATGCAGAGCAGAGACTTCTTGGCTCTGAACACAGAGAAAGAGAGAGAGAGAGAGAGAGAGAGAAACAGTGTTTGTTTTGACACGGAGAAGAAGAAGAAGA[T/A,AGAT,AGAAGAT]
GTTTTTGGTGTGGGTTTCTTGGGCGGAGAAAGAGGAGGAATTAATTGTACAAGAAGACGAAGACGAACGAAGACGAGGAGTAGAAGAAGTAGGGAGTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 31.10% 0.17% 0.00% ATCT: 17.20%; ATCTTCT: 3.22%
All Indica  2759 18.90% 51.80% 0.22% 0.00% ATCT: 28.78%; ATCTTCT: 0.33%
All Japonica  1512 99.20% 0.30% 0.00% 0.00% ATCT: 0.46%
Aus  269 51.30% 4.10% 0.00% 0.00% ATCTTCT: 44.61%
Indica I  595 46.10% 8.20% 0.50% 0.00% ATCT: 45.21%
Indica II  465 12.90% 61.90% 0.22% 0.00% ATCT: 24.95%
Indica III  913 6.00% 72.00% 0.11% 0.00% ATCT: 21.69%; ATCTTCT: 0.22%
Indica Intermediate  786 16.80% 55.30% 0.13% 0.00% ATCT: 26.84%; ATCTTCT: 0.89%
Temperate Japonica  767 99.60% 0.00% 0.00% 0.00% ATCT: 0.39%
Tropical Japonica  504 99.00% 0.60% 0.00% 0.00% ATCT: 0.40%
Japonica Intermediate  241 98.30% 0.80% 0.00% 0.00% ATCT: 0.83%
VI/Aromatic  96 80.20% 2.10% 1.04% 0.00% ATCTTCT: 15.62%; ATCT: 1.04%
Intermediate  90 51.10% 26.70% 1.11% 0.00% ATCT: 12.22%; ATCTTCT: 8.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227173062 A -> ATCTTCT LOC_Os12g43750.1 5_prime_UTR_variant ; 83.0bp to feature; MODIFIER silent_mutation Average:82.396; most accessible tissue: Zhenshan97 root, score: 92.66 N N N N
vg1227173062 A -> ATCTTCT LOC_Os12g43740.1 upstream_gene_variant ; 3435.0bp to feature; MODIFIER silent_mutation Average:82.396; most accessible tissue: Zhenshan97 root, score: 92.66 N N N N
vg1227173062 A -> ATCT LOC_Os12g43750.1 5_prime_UTR_variant ; 83.0bp to feature; MODIFIER silent_mutation Average:82.396; most accessible tissue: Zhenshan97 root, score: 92.66 N N N N
vg1227173062 A -> ATCT LOC_Os12g43740.1 upstream_gene_variant ; 3435.0bp to feature; MODIFIER silent_mutation Average:82.396; most accessible tissue: Zhenshan97 root, score: 92.66 N N N N
vg1227173062 A -> T LOC_Os12g43750.1 5_prime_UTR_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:82.396; most accessible tissue: Zhenshan97 root, score: 92.66 N N N N
vg1227173062 A -> T LOC_Os12g43740.1 upstream_gene_variant ; 3434.0bp to feature; MODIFIER silent_mutation Average:82.396; most accessible tissue: Zhenshan97 root, score: 92.66 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1227173062 A ATCT -0.08 -0.04 0.0 -0.07 0.01 0.07
vg1227173062 A ATCTT* -0.26 -0.01 0.08 -0.18 -0.1 -0.04
vg1227173062 A T 0.0 0.0 0.0 -0.01 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1227173062 NA 8.92E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.42E-09 mr1041_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 3.25E-06 mr1041_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.42E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 3.57E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 5.75E-09 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 4.59E-06 mr1293_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 3.72E-09 mr1294_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 4.77E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.06E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 7.18E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.94E-09 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.79E-08 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 6.93E-06 6.93E-06 mr1419_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.99E-08 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 6.59E-07 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.21E-09 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.53E-07 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 9.48E-06 3.09E-07 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.06E-06 mr1494_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.53E-09 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.74E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.09E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.56E-07 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 7.44E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.18E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 4.13E-11 mr1604_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.77E-06 mr1604_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.09E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 3.17E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.73E-08 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 7.23E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 6.25E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.06E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 6.72E-07 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.86E-06 mr1814_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.72E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 5.62E-10 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 3.98E-06 mr1824_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.91E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 4.50E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 1.26E-07 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 2.20E-06 mr1894_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227173062 NA 5.06E-08 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251