\
| Variant ID: vg1227054616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 27054616 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.00, others allele: 0.00, population size: 277. )
CACGTTGTTATATATTCTGAGTAGCTCTTACCACAAATGTTCTATATGGAGTTGCATTTGATAAAACAACTGATGTCAGCACCTCTGTTCCATCAGCCAA[A/T]
ACTACCTACAAGTTCCCATAATTTCAAGAGGTTCAAAGAAATGAAATAGGAGTACCATTTATCGGTTAGTCAAAGAACTTACCCCCTGTACCTTCCCAGA
TCTGGGAAGGTACAGGGGGTAAGTTCTTTGACTAACCGATAAATGGTACTCCTATTTCATTTCTTTGAACCTCTTGAAATTATGGGAACTTGTAGGTAGT[T/A]
TTGGCTGATGGAACAGAGGTGCTGACATCAGTTGTTTTATCAAATGCAACTCCATATAGAACATTTGTGGTAAGAGCTACTCAGAATATATAACAACGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.60% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 63.70% | 36.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.20% | 11.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 49.90% | 50.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 58.70% | 41.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 59.20% | 40.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1227054616 | A -> T | LOC_Os12g43590.1 | synonymous_variant ; p.Val331Val; LOW | synonymous_codon | Average:50.217; most accessible tissue: Zhenshan97 flower, score: 62.865 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1227054616 | NA | 2.22E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 7.43E-06 | mr1500 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 2.13E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 1.31E-06 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | 8.17E-06 | NA | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | 2.11E-06 | 2.32E-07 | mr1807 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 3.49E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 9.16E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 7.90E-06 | mr1984 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 2.21E-06 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 5.98E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 2.13E-08 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 1.72E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227054616 | NA | 3.96E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |