Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1226569792:

Variant ID: vg1226569792 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 26569792
Reference Allele: AGAlternative Allele: TG,A,AGG
Primary Allele: AGSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGAAAGTGGAAGAGAATGACATGCGGGTCCCATAATTTTTTTATTAAAAAACGCTGATTAGGATGCCACGTAGACCAAAACCACCGCGGATTGGGTCG[AG/TG,A,AGG]
GGGGGGTAATTCGTCCGGTTTGTATAGTTGGGGGTGAAGAATATCCAGTTTTGTGATTCAGGAGGGTAATTCGGACAACTGCGATAGTTCGGGGGAGAGG

Reverse complement sequence

CCTCTCCCCCGAACTATCGCAGTTGTCCGAATTACCCTCCTGAATCACAAAACTGGATATTCTTCACCCCCAACTATACAAACCGGACGAATTACCCCCC[CT/CA,T,CCT]
CGACCCAATCCGCGGTGGTTTTGGTCTACGTGGCATCCTAATCAGCGTTTTTTAATAAAAAAATTATGGGACCCGCATGTCATTCTCTTCCACTTTCCCC

Allele Frequencies:

Populations Population SizeFrequency of AG(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.00% 0.23% 0.00% A: 0.49%; AGG: 0.06%
All Indica  2759 42.30% 56.90% 0.33% 0.00% A: 0.33%; AGG: 0.07%
All Japonica  1512 99.60% 0.20% 0.07% 0.00% A: 0.13%
Aus  269 90.30% 4.80% 0.00% 0.00% A: 4.46%; AGG: 0.37%
Indica I  595 89.70% 9.70% 0.50% 0.00% NA
Indica II  465 18.90% 80.40% 0.43% 0.00% A: 0.22%
Indica III  913 21.20% 78.00% 0.11% 0.00% A: 0.44%; AGG: 0.22%
Indica Intermediate  786 44.80% 54.30% 0.38% 0.00% A: 0.51%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.00% A: 0.20%
Japonica Intermediate  241 98.30% 0.80% 0.41% 0.00% A: 0.41%
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226569792 AG -> A LOC_Os12g42750-LOC_Os12g42760 intergenic_region ; MODIFIER silent_mutation Average:93.962; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1226569792 AG -> AGG LOC_Os12g42750-LOC_Os12g42760 intergenic_region ; MODIFIER silent_mutation Average:93.962; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1226569792 AG -> TG LOC_Os12g42750-LOC_Os12g42760 intergenic_region ; MODIFIER silent_mutation Average:93.962; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1226569792 AG A 0.01 0.01 -0.02 0.01 -0.05 -0.11
vg1226569792 AG AGG 0.0 -0.07 -0.1 0.03 -0.02 -0.03
vg1226569792 AG TG -0.02 -0.01 -0.01 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226569792 3.26E-06 3.26E-06 mr1736 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251