\
| Variant ID: vg1226005906 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 26005906 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, A: 0.33, others allele: 0.00, population size: 58. )
TCATAATTCAACAATTCTGCAAGGCAGGAACAGAAGGAGGCTAGTTGCAGTATTGTCATTATAGCATGTCCAGGTAATTTCTTAGCCAGATAAAAATGCA[A/T]
AAACAGATCTTGGCAACAAAGAAAAAAGAGCAAAACGGATAGATGTCATGTCTAATGGAAATGCTATCTAAAAGGCATAGTACATGATTTTATGTCAATT
AATTGACATAAAATCATGTACTATGCCTTTTAGATAGCATTTCCATTAGACATGACATCTATCCGTTTTGCTCTTTTTTCTTTGTTGCCAAGATCTGTTT[T/A]
TGCATTTTTATCTGGCTAAGAAATTACCTGGACATGCTATAATGACAATACTGCAACTAGCCTCCTTCTGTTCCTGCCTTGCAGAATTGTTGAATTATGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 37.10% | 0.06% | 0.32% | NA |
| All Indica | 2759 | 95.20% | 4.30% | 0.07% | 0.40% | NA |
| All Japonica | 1512 | 0.70% | 99.00% | 0.07% | 0.20% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 7.70% | 0.17% | 0.67% | NA |
| Indica II | 465 | 94.80% | 4.50% | 0.00% | 0.65% | NA |
| Indica III | 913 | 97.60% | 2.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 95.40% | 4.10% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 0.10% | 99.60% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 1.40% | 98.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1226005906 | A -> DEL | N | N | silent_mutation | Average:48.02; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1226005906 | A -> T | LOC_Os12g41940.1 | downstream_gene_variant ; 4056.0bp to feature; MODIFIER | silent_mutation | Average:48.02; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1226005906 | A -> T | LOC_Os12g41940.2 | downstream_gene_variant ; 4282.0bp to feature; MODIFIER | silent_mutation | Average:48.02; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1226005906 | A -> T | LOC_Os12g41950.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.02; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1226005906 | NA | 6.29E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 2.94E-38 | mr1105 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 5.57E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 6.62E-78 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 3.89E-24 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 7.33E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 2.08E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 2.76E-87 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 2.20E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 1.26E-40 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 7.92E-14 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 8.16E-43 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 5.75E-35 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 2.79E-36 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 1.75E-31 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 3.87E-20 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 1.45E-18 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 1.83E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 2.89E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 5.50E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 3.25E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 8.15E-40 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 4.99E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 3.23E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 1.45E-18 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 1.23E-22 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 2.15E-48 | mr1542_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 1.27E-68 | mr1594_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 6.89E-20 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226005906 | NA | 6.32E-33 | mr1723_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |