\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226005906:

Variant ID: vg1226005906 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26005906
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, A: 0.33, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


TCATAATTCAACAATTCTGCAAGGCAGGAACAGAAGGAGGCTAGTTGCAGTATTGTCATTATAGCATGTCCAGGTAATTTCTTAGCCAGATAAAAATGCA[A/T]
AAACAGATCTTGGCAACAAAGAAAAAAGAGCAAAACGGATAGATGTCATGTCTAATGGAAATGCTATCTAAAAGGCATAGTACATGATTTTATGTCAATT

Reverse complement sequence

AATTGACATAAAATCATGTACTATGCCTTTTAGATAGCATTTCCATTAGACATGACATCTATCCGTTTTGCTCTTTTTTCTTTGTTGCCAAGATCTGTTT[T/A]
TGCATTTTTATCTGGCTAAGAAATTACCTGGACATGCTATAATGACAATACTGCAACTAGCCTCCTTCTGTTCCTGCCTTGCAGAATTGTTGAATTATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 37.10% 0.06% 0.32% NA
All Indica  2759 95.20% 4.30% 0.07% 0.40% NA
All Japonica  1512 0.70% 99.00% 0.07% 0.20% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 91.40% 7.70% 0.17% 0.67% NA
Indica II  465 94.80% 4.50% 0.00% 0.65% NA
Indica III  913 97.60% 2.30% 0.00% 0.11% NA
Indica Intermediate  786 95.40% 4.10% 0.13% 0.38% NA
Temperate Japonica  767 0.10% 99.60% 0.13% 0.13% NA
Tropical Japonica  504 1.40% 98.40% 0.00% 0.20% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226005906 A -> DEL N N silent_mutation Average:48.02; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg1226005906 A -> T LOC_Os12g41940.1 downstream_gene_variant ; 4056.0bp to feature; MODIFIER silent_mutation Average:48.02; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg1226005906 A -> T LOC_Os12g41940.2 downstream_gene_variant ; 4282.0bp to feature; MODIFIER silent_mutation Average:48.02; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg1226005906 A -> T LOC_Os12g41950.1 intron_variant ; MODIFIER silent_mutation Average:48.02; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226005906 NA 6.29E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 2.94E-38 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 5.57E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 6.62E-78 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 3.89E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 7.33E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 2.08E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 2.76E-87 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 2.20E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 1.26E-40 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 7.92E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 8.16E-43 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 5.75E-35 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 2.79E-36 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 1.75E-31 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 3.87E-20 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 1.45E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 1.83E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 2.89E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 5.50E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 3.25E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 8.15E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 4.99E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 3.23E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 1.45E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 1.23E-22 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 2.15E-48 mr1542_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 1.27E-68 mr1594_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 6.89E-20 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226005906 NA 6.32E-33 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251