\
| Variant ID: vg1225988493 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 25988493 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.50, G: 0.50, others allele: 0.00, population size: 96. )
GAAGGCCTGGGAGATTCGTGGAGCTCCAATAAAGTTCCTATCAATCGAGCGTGCCCATTAGTTCGATCCTACAACTAACAGCATATAAATAAACTTTTTA[G/C]
TAACAATCTAAGAGCAAAGTCAATAGCGAAAGTAAGTAGTACGAAATATTGGCTTTAGGGAAGCATGAATGGGTTTAATTGTTGCATGCATATGTGATCA
TGATCACATATGCATGCAACAATTAAACCCATTCATGCTTCCCTAAAGCCAATATTTCGTACTACTTACTTTCGCTATTGACTTTGCTCTTAGATTGTTA[C/G]
TAAAAAGTTTATTTATATGCTGTTAGTTGTAGGATCGAACTAATGGGCACGCTCGATTGATAGGAACTTTATTGGAGCTCCACGAATCTCCCAGGCCTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 37.90% | 0.11% | 0.28% | NA |
| All Indica | 2759 | 93.70% | 5.90% | 0.00% | 0.47% | NA |
| All Japonica | 1512 | 0.70% | 99.00% | 0.26% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.10% | 12.30% | 0.00% | 0.67% | NA |
| Indica II | 465 | 94.80% | 4.50% | 0.00% | 0.65% | NA |
| Indica III | 913 | 97.50% | 2.40% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 93.50% | 5.90% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 0.10% | 99.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 56.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1225988493 | G -> C | LOC_Os12g41920.1 | upstream_gene_variant ; 506.0bp to feature; MODIFIER | silent_mutation | Average:61.555; most accessible tissue: Callus, score: 83.08 | N | N | N | N |
| vg1225988493 | G -> C | LOC_Os12g41930.1 | upstream_gene_variant ; 1571.0bp to feature; MODIFIER | silent_mutation | Average:61.555; most accessible tissue: Callus, score: 83.08 | N | N | N | N |
| vg1225988493 | G -> C | LOC_Os12g41920.2 | upstream_gene_variant ; 506.0bp to feature; MODIFIER | silent_mutation | Average:61.555; most accessible tissue: Callus, score: 83.08 | N | N | N | N |
| vg1225988493 | G -> C | LOC_Os12g41920.3 | upstream_gene_variant ; 506.0bp to feature; MODIFIER | silent_mutation | Average:61.555; most accessible tissue: Callus, score: 83.08 | N | N | N | N |
| vg1225988493 | G -> C | LOC_Os12g41930.2 | upstream_gene_variant ; 1571.0bp to feature; MODIFIER | silent_mutation | Average:61.555; most accessible tissue: Callus, score: 83.08 | N | N | N | N |
| vg1225988493 | G -> C | LOC_Os12g41930.3 | upstream_gene_variant ; 1580.0bp to feature; MODIFIER | silent_mutation | Average:61.555; most accessible tissue: Callus, score: 83.08 | N | N | N | N |
| vg1225988493 | G -> C | LOC_Os12g41920-LOC_Os12g41930 | intergenic_region ; MODIFIER | silent_mutation | Average:61.555; most accessible tissue: Callus, score: 83.08 | N | N | N | N |
| vg1225988493 | G -> DEL | N | N | silent_mutation | Average:61.555; most accessible tissue: Callus, score: 83.08 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1225988493 | NA | 3.47E-36 | mr1105 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 1.67E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 1.19E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 9.84E-24 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 2.01E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 7.60E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 9.98E-36 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 4.49E-13 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 1.18E-38 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 1.82E-31 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 6.52E-34 | mr1723 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 6.79E-12 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 4.89E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225988493 | NA | 5.19E-19 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |