\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225988493:

Variant ID: vg1225988493 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25988493
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.50, G: 0.50, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGCCTGGGAGATTCGTGGAGCTCCAATAAAGTTCCTATCAATCGAGCGTGCCCATTAGTTCGATCCTACAACTAACAGCATATAAATAAACTTTTTA[G/C]
TAACAATCTAAGAGCAAAGTCAATAGCGAAAGTAAGTAGTACGAAATATTGGCTTTAGGGAAGCATGAATGGGTTTAATTGTTGCATGCATATGTGATCA

Reverse complement sequence

TGATCACATATGCATGCAACAATTAAACCCATTCATGCTTCCCTAAAGCCAATATTTCGTACTACTTACTTTCGCTATTGACTTTGCTCTTAGATTGTTA[C/G]
TAAAAAGTTTATTTATATGCTGTTAGTTGTAGGATCGAACTAATGGGCACGCTCGATTGATAGGAACTTTATTGGAGCTCCACGAATCTCCCAGGCCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 37.90% 0.11% 0.28% NA
All Indica  2759 93.70% 5.90% 0.00% 0.47% NA
All Japonica  1512 0.70% 99.00% 0.26% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 87.10% 12.30% 0.00% 0.67% NA
Indica II  465 94.80% 4.50% 0.00% 0.65% NA
Indica III  913 97.50% 2.40% 0.00% 0.11% NA
Indica Intermediate  786 93.50% 5.90% 0.00% 0.64% NA
Temperate Japonica  767 0.10% 99.60% 0.26% 0.00% NA
Tropical Japonica  504 1.40% 98.40% 0.20% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225988493 G -> C LOC_Os12g41920.1 upstream_gene_variant ; 506.0bp to feature; MODIFIER silent_mutation Average:61.555; most accessible tissue: Callus, score: 83.08 N N N N
vg1225988493 G -> C LOC_Os12g41930.1 upstream_gene_variant ; 1571.0bp to feature; MODIFIER silent_mutation Average:61.555; most accessible tissue: Callus, score: 83.08 N N N N
vg1225988493 G -> C LOC_Os12g41920.2 upstream_gene_variant ; 506.0bp to feature; MODIFIER silent_mutation Average:61.555; most accessible tissue: Callus, score: 83.08 N N N N
vg1225988493 G -> C LOC_Os12g41920.3 upstream_gene_variant ; 506.0bp to feature; MODIFIER silent_mutation Average:61.555; most accessible tissue: Callus, score: 83.08 N N N N
vg1225988493 G -> C LOC_Os12g41930.2 upstream_gene_variant ; 1571.0bp to feature; MODIFIER silent_mutation Average:61.555; most accessible tissue: Callus, score: 83.08 N N N N
vg1225988493 G -> C LOC_Os12g41930.3 upstream_gene_variant ; 1580.0bp to feature; MODIFIER silent_mutation Average:61.555; most accessible tissue: Callus, score: 83.08 N N N N
vg1225988493 G -> C LOC_Os12g41920-LOC_Os12g41930 intergenic_region ; MODIFIER silent_mutation Average:61.555; most accessible tissue: Callus, score: 83.08 N N N N
vg1225988493 G -> DEL N N silent_mutation Average:61.555; most accessible tissue: Callus, score: 83.08 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225988493 NA 3.47E-36 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 1.67E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 1.19E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 9.84E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 2.01E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 7.60E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 9.98E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 4.49E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 1.18E-38 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 1.82E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 6.52E-34 mr1723 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 6.79E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 4.89E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493 NA 5.19E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251