Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225958017:

Variant ID: vg1225958017 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 25958017
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAATGCTTTTTTTTATTTGTTTCACACTACAAGACGTTTTGGATTTTTAATGGATTCATGCATGAATTTAATTTATGTGTGTGCTTCATATATGTGTC[T/C,A]
AAATTTATAGTTAATCCACACGAGGGATAGAAAGACCAAAACAACTTATAATATGGAATGGAGCGAGTACTGCCACCGTCTCAAAATAAATTTATTTTTC

Reverse complement sequence

GAAAAATAAATTTATTTTGAGACGGTGGCAGTACTCGCTCCATTCCATATTATAAGTTGTTTTGGTCTTTCTATCCCTCGTGTGGATTAACTATAAATTT[A/G,T]
GACACATATATGAAGCACACACATAAATTAAATTCATGCATGAATCCATTAAAAATCCAAAACGTCTTGTAGTGTGAAACAAATAAAAAAAAGCATTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.00%	31.70%	0.87%	4.36%	A: 0.11%
All Indica	2759	94.20%	5.70%	0.07%	0.04%	A: 0.04%
All Japonica	1512	1.20%	83.10%	2.25%	13.43%	NA
Aus	269	96.30%	1.10%	0.74%	0.37%	A: 1.49%
Indica I	595	87.40%	12.60%	0.00%	0.00%	NA
Indica II	465	94.80%	4.90%	0.22%	0.00%	NA
Indica III	913	98.70%	1.10%	0.00%	0.11%	A: 0.11%
Indica Intermediate	786	93.80%	6.10%	0.13%	0.00%	NA
Temperate Japonica	767	0.00%	80.20%	3.26%	16.56%	NA
Tropical Japonica	504	2.40%	93.80%	0.00%	3.77%	NA
Japonica Intermediate	241	2.50%	70.10%	3.73%	23.65%	NA
VI/Aromatic	96	61.50%	38.50%	0.00%	0.00%	NA
Intermediate	90	47.80%	47.80%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1225958017	T -> C	LOC_Os12g41880.2	upstream_gene_variant ; 653.0bp to feature; MODIFIER	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1225958017	T -> C	LOC_Os12g41880.1	upstream_gene_variant ; 653.0bp to feature; MODIFIER	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1225958017	T -> C	LOC_Os12g41890.1	downstream_gene_variant ; 2793.0bp to feature; MODIFIER	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1225958017	T -> C	LOC_Os12g41880-LOC_Os12g41890	intergenic_region ; MODIFIER	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1225958017	T -> DEL	N	N	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1225958017	T -> A	LOC_Os12g41880.2	upstream_gene_variant ; 653.0bp to feature; MODIFIER	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1225958017	T -> A	LOC_Os12g41880.1	upstream_gene_variant ; 653.0bp to feature; MODIFIER	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1225958017	T -> A	LOC_Os12g41890.1	downstream_gene_variant ; 2793.0bp to feature; MODIFIER	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1225958017	T -> A	LOC_Os12g41880-LOC_Os12g41890	intergenic_region ; MODIFIER	silent_mutation	Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1225958017	NA	7.54E-39	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	6.32E-22	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	7.90E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	3.10E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	2.26E-39	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	1.30E-19	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	4.89E-37	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	4.95E-18	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	5.81E-14	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	5.46E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	1.20E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	1.35E-06	1.12E-32	mr1723	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	1.13E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	3.96E-30	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	2.65E-32	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	7.89E-17	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	2.62E-18	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	3.16E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	7.98E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	5.99E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	8.72E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017	NA	8.74E-20	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251