\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225958017:

Variant ID: vg1225958017 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25958017
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAATGCTTTTTTTTATTTGTTTCACACTACAAGACGTTTTGGATTTTTAATGGATTCATGCATGAATTTAATTTATGTGTGTGCTTCATATATGTGTC[T/C,A]
AAATTTATAGTTAATCCACACGAGGGATAGAAAGACCAAAACAACTTATAATATGGAATGGAGCGAGTACTGCCACCGTCTCAAAATAAATTTATTTTTC

Reverse complement sequence

GAAAAATAAATTTATTTTGAGACGGTGGCAGTACTCGCTCCATTCCATATTATAAGTTGTTTTGGTCTTTCTATCCCTCGTGTGGATTAACTATAAATTT[A/G,T]
GACACATATATGAAGCACACACATAAATTAAATTCATGCATGAATCCATTAAAAATCCAAAACGTCTTGTAGTGTGAAACAAATAAAAAAAAGCATTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 31.70% 0.87% 4.36% A: 0.11%
All Indica  2759 94.20% 5.70% 0.07% 0.04% A: 0.04%
All Japonica  1512 1.20% 83.10% 2.25% 13.43% NA
Aus  269 96.30% 1.10% 0.74% 0.37% A: 1.49%
Indica I  595 87.40% 12.60% 0.00% 0.00% NA
Indica II  465 94.80% 4.90% 0.22% 0.00% NA
Indica III  913 98.70% 1.10% 0.00% 0.11% A: 0.11%
Indica Intermediate  786 93.80% 6.10% 0.13% 0.00% NA
Temperate Japonica  767 0.00% 80.20% 3.26% 16.56% NA
Tropical Japonica  504 2.40% 93.80% 0.00% 3.77% NA
Japonica Intermediate  241 2.50% 70.10% 3.73% 23.65% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 47.80% 47.80% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225958017 T -> C LOC_Os12g41880.2 upstream_gene_variant ; 653.0bp to feature; MODIFIER silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1225958017 T -> C LOC_Os12g41880.1 upstream_gene_variant ; 653.0bp to feature; MODIFIER silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1225958017 T -> C LOC_Os12g41890.1 downstream_gene_variant ; 2793.0bp to feature; MODIFIER silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1225958017 T -> C LOC_Os12g41880-LOC_Os12g41890 intergenic_region ; MODIFIER silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1225958017 T -> DEL N N silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1225958017 T -> A LOC_Os12g41880.2 upstream_gene_variant ; 653.0bp to feature; MODIFIER silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1225958017 T -> A LOC_Os12g41880.1 upstream_gene_variant ; 653.0bp to feature; MODIFIER silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1225958017 T -> A LOC_Os12g41890.1 downstream_gene_variant ; 2793.0bp to feature; MODIFIER silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg1225958017 T -> A LOC_Os12g41880-LOC_Os12g41890 intergenic_region ; MODIFIER silent_mutation Average:71.969; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225958017 NA 7.54E-39 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 6.32E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 7.90E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 3.10E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 2.26E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 1.30E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 4.89E-37 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 4.95E-18 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 5.81E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 5.46E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 1.20E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 1.35E-06 1.12E-32 mr1723 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 1.13E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 3.96E-30 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 2.65E-32 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 7.89E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 2.62E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 3.16E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 7.98E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 5.99E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 8.72E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225958017 NA 8.74E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251