\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225819892:

Variant ID: vg1225819892 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25819892
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATAAGACTTTCTAGCATTGCCCACATTTATATGGATGTTAATGAATCTACACATATATGTTTAGATTCATTAACATATATATGAATGTGGGTAATGCTA[A/G]
AAAATCTTATAATATGAAACGGAGGAAGTAGATAACATGTATAGCATGCTATAGGCATGAGTGAAAATGTAAGTCAATTTGTTGTGGATGTGAGAGGTGT

Reverse complement sequence

ACACCTCTCACATCCACAACAAATTGACTTACATTTTCACTCATGCCTATAGCATGCTATACATGTTATCTACTTCCTCCGTTTCATATTATAAGATTTT[T/C]
TAGCATTACCCACATTCATATATATGTTAATGAATCTAAACATATATGTGTAGATTCATTAACATCCATATAAATGTGGGCAATGCTAGAAAGTCTTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 13.20% 0.34% 0.00% NA
All Indica  2759 98.00% 2.00% 0.04% 0.00% NA
All Japonica  1512 76.70% 22.50% 0.86% 0.00% NA
Aus  269 23.40% 76.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.70% 0.13% 0.00% NA
Temperate Japonica  767 97.90% 1.80% 0.26% 0.00% NA
Tropical Japonica  504 36.70% 61.10% 2.18% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225819892 A -> G LOC_Os12g41700.1 upstream_gene_variant ; 1018.0bp to feature; MODIFIER silent_mutation Average:55.097; most accessible tissue: Callus, score: 67.137 N N N N
vg1225819892 A -> G LOC_Os12g41710.1 downstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:55.097; most accessible tissue: Callus, score: 67.137 N N N N
vg1225819892 A -> G LOC_Os12g41710.2 downstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:55.097; most accessible tissue: Callus, score: 67.137 N N N N
vg1225819892 A -> G LOC_Os12g41710.3 downstream_gene_variant ; 948.0bp to feature; MODIFIER silent_mutation Average:55.097; most accessible tissue: Callus, score: 67.137 N N N N
vg1225819892 A -> G LOC_Os12g41710.4 downstream_gene_variant ; 948.0bp to feature; MODIFIER silent_mutation Average:55.097; most accessible tissue: Callus, score: 67.137 N N N N
vg1225819892 A -> G LOC_Os12g41700-LOC_Os12g41710 intergenic_region ; MODIFIER silent_mutation Average:55.097; most accessible tissue: Callus, score: 67.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225819892 NA 2.70E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 2.28E-09 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 3.04E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 2.52E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 4.48E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 7.35E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 8.93E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 6.41E-23 mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 6.91E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 1.73E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 1.64E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225819892 NA 3.90E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251