| Variant ID: vg1225819892 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 25819892 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TATAAGACTTTCTAGCATTGCCCACATTTATATGGATGTTAATGAATCTACACATATATGTTTAGATTCATTAACATATATATGAATGTGGGTAATGCTA[A/G]
AAAATCTTATAATATGAAACGGAGGAAGTAGATAACATGTATAGCATGCTATAGGCATGAGTGAAAATGTAAGTCAATTTGTTGTGGATGTGAGAGGTGT
ACACCTCTCACATCCACAACAAATTGACTTACATTTTCACTCATGCCTATAGCATGCTATACATGTTATCTACTTCCTCCGTTTCATATTATAAGATTTT[T/C]
TAGCATTACCCACATTCATATATATGTTAATGAATCTAAACATATATGTGTAGATTCATTAACATCCATATAAATGTGGGCAATGCTAGAAAGTCTTATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.40% | 13.20% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 76.70% | 22.50% | 0.86% | 0.00% | NA |
| Aus | 269 | 23.40% | 76.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.90% | 1.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 36.70% | 61.10% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1225819892 | A -> G | LOC_Os12g41700.1 | upstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:55.097; most accessible tissue: Callus, score: 67.137 | N | N | N | N |
| vg1225819892 | A -> G | LOC_Os12g41710.1 | downstream_gene_variant ; 857.0bp to feature; MODIFIER | silent_mutation | Average:55.097; most accessible tissue: Callus, score: 67.137 | N | N | N | N |
| vg1225819892 | A -> G | LOC_Os12g41710.2 | downstream_gene_variant ; 857.0bp to feature; MODIFIER | silent_mutation | Average:55.097; most accessible tissue: Callus, score: 67.137 | N | N | N | N |
| vg1225819892 | A -> G | LOC_Os12g41710.3 | downstream_gene_variant ; 948.0bp to feature; MODIFIER | silent_mutation | Average:55.097; most accessible tissue: Callus, score: 67.137 | N | N | N | N |
| vg1225819892 | A -> G | LOC_Os12g41710.4 | downstream_gene_variant ; 948.0bp to feature; MODIFIER | silent_mutation | Average:55.097; most accessible tissue: Callus, score: 67.137 | N | N | N | N |
| vg1225819892 | A -> G | LOC_Os12g41700-LOC_Os12g41710 | intergenic_region ; MODIFIER | silent_mutation | Average:55.097; most accessible tissue: Callus, score: 67.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1225819892 | NA | 2.70E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 2.28E-09 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 3.04E-12 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 2.52E-11 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 4.48E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 7.35E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 8.93E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 6.41E-23 | mr1530_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 6.91E-06 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 1.73E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 1.64E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225819892 | NA | 3.90E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |