\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225586451:

Variant ID: vg1225586451 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 25586451
Reference Allele: AAlternative Allele: T,C,AT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, C: 0.11, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGATTGGTGAGTTGGATCCATGAAAGGTATTGGTTGATTGATTTCCACGTGGAATATTTTAGCTTAGTACTCCCTTCATTTCCTATTACATTTTGACT[A/T,C,AT]
TTTTTTTTAACTCGTAACCTTTAAGCTTAACTAAATTTATATGAAAAAACATAGCAATATTTTCAACCCAAAGTAGCATTTTATTAGTTCGCCGCAGCCA

Reverse complement sequence

TGGCTGCGGCGAACTAATAAAATGCTACTTTGGGTTGAAAATATTGCTATGTTTTTTCATATAAATTTAGTTAAGCTTAAAGGTTACGAGTTAAAAAAAA[T/A,G,AT]
AGTCAAAATGTAATAGGAAATGAAGGGAGTACTAAGCTAAAATATTCCACGTGGAAATCAATCAACCAATACCTTTCATGGATCCAACTCACCAATCCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 0.20% 0.97% 0.00% C: 0.17%; AT: 0.04%
All Indica  2759 98.70% 0.10% 1.01% 0.00% C: 0.14%; AT: 0.04%
All Japonica  1512 99.70% 0.00% 0.20% 0.00% AT: 0.07%
Aus  269 92.20% 2.20% 4.09% 0.00% C: 1.49%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 0.00% 0.86% 0.00% C: 0.43%
Indica III  913 96.80% 0.30% 2.52% 0.00% C: 0.22%; AT: 0.11%
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.00% AT: 0.20%
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225586451 A -> C LOC_Os12g41250.1 downstream_gene_variant ; 4387.0bp to feature; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N
vg1225586451 A -> C LOC_Os12g41260.1 downstream_gene_variant ; 56.0bp to feature; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N
vg1225586451 A -> C LOC_Os12g41260-LOC_Os12g41270 intergenic_region ; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N
vg1225586451 A -> AT LOC_Os12g41250.1 downstream_gene_variant ; 4388.0bp to feature; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N
vg1225586451 A -> AT LOC_Os12g41260.1 downstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N
vg1225586451 A -> AT LOC_Os12g41260-LOC_Os12g41270 intergenic_region ; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N
vg1225586451 A -> T LOC_Os12g41250.1 downstream_gene_variant ; 4387.0bp to feature; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N
vg1225586451 A -> T LOC_Os12g41260.1 downstream_gene_variant ; 56.0bp to feature; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N
vg1225586451 A -> T LOC_Os12g41260-LOC_Os12g41270 intergenic_region ; MODIFIER silent_mutation Average:32.355; most accessible tissue: Callus, score: 74.086 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225586451 NA 8.81E-06 mr1057 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 2.03E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 1.66E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 1.25E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 4.23E-08 mr1057_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 6.99E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 3.63E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 2.10E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 3.14E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 1.03E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 4.47E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 2.14E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 5.40E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 2.05E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 1.63E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 2.14E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 2.70E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 2.92E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 7.52E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 8.14E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 3.60E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451 NA 9.72E-08 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251