Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225586451:

Variant ID: vg1225586451 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 25586451
Reference Allele: A	Alternative Allele: T,C,AT
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, C: 0.11, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGATTGGTGAGTTGGATCCATGAAAGGTATTGGTTGATTGATTTCCACGTGGAATATTTTAGCTTAGTACTCCCTTCATTTCCTATTACATTTTGACT[A/T,C,AT]
TTTTTTTTAACTCGTAACCTTTAAGCTTAACTAAATTTATATGAAAAAACATAGCAATATTTTCAACCCAAAGTAGCATTTTATTAGTTCGCCGCAGCCA

Reverse complement sequence

TGGCTGCGGCGAACTAATAAAATGCTACTTTGGGTTGAAAATATTGCTATGTTTTTTCATATAAATTTAGTTAAGCTTAAAGGTTACGAGTTAAAAAAAA[T/A,G,AT]
AGTCAAAATGTAATAGGAAATGAAGGGAGTACTAAGCTAAAATATTCCACGTGGAAATCAATCAACCAATACCTTTCATGGATCCAACTCACCAATCCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.60%	0.20%	0.97%	0.00%	C: 0.17%; AT: 0.04%
All Indica	2759	98.70%	0.10%	1.01%	0.00%	C: 0.14%; AT: 0.04%
All Japonica	1512	99.70%	0.00%	0.20%	0.00%	AT: 0.07%
Aus	269	92.20%	2.20%	4.09%	0.00%	C: 1.49%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	0.00%	0.86%	0.00%	C: 0.43%
Indica III	913	96.80%	0.30%	2.52%	0.00%	C: 0.22%; AT: 0.11%
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.00%	AT: 0.20%
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	0.00%	4.17%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1225586451	A -> C	LOC_Os12g41250.1	downstream_gene_variant ; 4387.0bp to feature; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N
vg1225586451	A -> C	LOC_Os12g41260.1	downstream_gene_variant ; 56.0bp to feature; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N
vg1225586451	A -> C	LOC_Os12g41260-LOC_Os12g41270	intergenic_region ; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N
vg1225586451	A -> AT	LOC_Os12g41250.1	downstream_gene_variant ; 4388.0bp to feature; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N
vg1225586451	A -> AT	LOC_Os12g41260.1	downstream_gene_variant ; 57.0bp to feature; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N
vg1225586451	A -> AT	LOC_Os12g41260-LOC_Os12g41270	intergenic_region ; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N
vg1225586451	A -> T	LOC_Os12g41250.1	downstream_gene_variant ; 4387.0bp to feature; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N
vg1225586451	A -> T	LOC_Os12g41260.1	downstream_gene_variant ; 56.0bp to feature; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N
vg1225586451	A -> T	LOC_Os12g41260-LOC_Os12g41270	intergenic_region ; MODIFIER	silent_mutation	Average:32.355; most accessible tissue: Callus, score: 74.086	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1225586451	NA	8.81E-06	mr1057	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	2.03E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	1.66E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	1.25E-06	mr1931	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	4.23E-08	mr1057_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	6.99E-10	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	3.63E-08	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	2.10E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	3.14E-07	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	1.03E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	4.47E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	2.14E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	5.40E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	2.05E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	1.63E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	2.14E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	2.70E-06	mr1652_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	2.92E-09	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	7.52E-06	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	8.14E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	3.60E-06	mr1843_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225586451	NA	9.72E-08	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251