\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225527437:

Variant ID: vg1225527437 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 25527437
Reference Allele: ATTTTAlternative Allele: TTTTT,A
Primary Allele: TTTTTSecondary Allele: ATTTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTAGAAAAACATACTATCTTCGTCCCAAAAAAAAGTGCAACCGTGGATATCCATGTCCAACATTTGATCGTTCGTTTTATTTGAAAAATTTATAAA[ATTTT/TTTTT,A]
TTTAAAAATATTAGCCATACATAAAGTGCTATTTATGTTTTATCATGTACTAGTAACAATATTAATCGTAAAAGTTTTTCTAATAAGACGAACGGTTAAA

Reverse complement sequence

TTTAACCGTTCGTCTTATTAGAAAAACTTTTACGATTAATATTGTTACTAGTACATGATAAAACATAAATAGCACTTTATGTATGGCTAATATTTTTAAA[AAAAT/AAAAA,T]
TTTATAAATTTTTCAAATAAAACGAACGATCAAATGTTGGACATGGATATCCACGGTTGCACTTTTTTTTGGGACGAAGATAGTATGTTTTTCTAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of TTTTT(primary allele) Frequency of ATTTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 33.60% 0.95% 0.00% A: 2.39%
All Indica  2759 79.60% 19.70% 0.58% 0.00% A: 0.11%
All Japonica  1512 44.50% 53.80% 1.72% 0.00% NA
Aus  269 1.50% 62.10% 0.74% 0.00% A: 35.69%
Indica I  595 88.40% 10.30% 1.34% 0.00% NA
Indica II  465 88.00% 11.80% 0.22% 0.00% NA
Indica III  913 70.50% 29.20% 0.22% 0.00% NA
Indica Intermediate  786 78.60% 20.40% 0.64% 0.00% A: 0.38%
Temperate Japonica  767 11.20% 86.80% 1.96% 0.00% NA
Tropical Japonica  504 93.50% 5.40% 1.19% 0.00% NA
Japonica Intermediate  241 48.10% 49.80% 2.07% 0.00% NA
VI/Aromatic  96 59.40% 29.20% 1.04% 0.00% A: 10.42%
Intermediate  90 56.70% 38.90% 0.00% 0.00% A: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225527437 ATTTT -> A LOC_Os12g41180.1 upstream_gene_variant ; 4997.0bp to feature; MODIFIER silent_mutation Average:73.014; most accessible tissue: Zhenshan97 flower, score: 94.26 N N N N
vg1225527437 ATTTT -> A LOC_Os12g41190.1 downstream_gene_variant ; 865.0bp to feature; MODIFIER silent_mutation Average:73.014; most accessible tissue: Zhenshan97 flower, score: 94.26 N N N N
vg1225527437 ATTTT -> A LOC_Os12g41180-LOC_Os12g41190 intergenic_region ; MODIFIER silent_mutation Average:73.014; most accessible tissue: Zhenshan97 flower, score: 94.26 N N N N
vg1225527437 ATTTT -> TTTTT LOC_Os12g41180.1 upstream_gene_variant ; 4996.0bp to feature; MODIFIER silent_mutation Average:73.014; most accessible tissue: Zhenshan97 flower, score: 94.26 N N N N
vg1225527437 ATTTT -> TTTTT LOC_Os12g41190.1 downstream_gene_variant ; 866.0bp to feature; MODIFIER silent_mutation Average:73.014; most accessible tissue: Zhenshan97 flower, score: 94.26 N N N N
vg1225527437 ATTTT -> TTTTT LOC_Os12g41180-LOC_Os12g41190 intergenic_region ; MODIFIER silent_mutation Average:73.014; most accessible tissue: Zhenshan97 flower, score: 94.26 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1225527437 ATTTT A 0.04 0.1 0.12 -0.11 -0.21 -0.57
vg1225527437 ATTTT TTTTT -0.01 -0.02 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225527437 NA 4.07E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 2.92E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 1.87E-11 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 4.82E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 1.46E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 1.87E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 1.71E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 6.05E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 3.02E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 2.40E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 5.17E-06 mr1078_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225527437 NA 1.16E-06 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251