\
| Variant ID: vg1224749159 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24749159 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 97. )
GGCCGTGACAGGACCCTTCGCATAACCCCCTCTAACCGATCGCACCACACCTTAGGGTTCGCCCCCGTCCCCAGCAGGCAACGGGCAGCCCCCCTTTCGT[A/G]
CCGCAGTGAATCCGGAAGCCGATCAACCGGACACCCGGCCGACTTAACTCCATCACGCCCACCCTCGCCTGGGTACGTCGGCTAGAGAAAAGCTACACTA
TAGTGTAGCTTTTCTCTAGCCGACGTACCCAGGCGAGGGTGGGCGTGATGGAGTTAAGTCGGCCGGGTGTCCGGTTGATCGGCTTCCGGATTCACTGCGG[T/C]
ACGAAAGGGGGGCTGCCCGTTGCCTGCTGGGGACGGGGGCGAACCCTAAGGTGTGGTGCGATCGGTTAGAGGGGGTTATGCGAAGGGTCCTGTCACGGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.20% | 0.08% | 0.63% | NA |
| All Indica | 2759 | 93.70% | 6.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 22.60% | 75.70% | 0.00% | 1.65% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 6.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.90% | 40.70% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 10.80% | 83.80% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 12.50% | 80.20% | 2.08% | 5.21% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224749159 | A -> DEL | N | N | silent_mutation | Average:31.14; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg1224749159 | A -> G | LOC_Os12g40030.1 | upstream_gene_variant ; 1335.0bp to feature; MODIFIER | silent_mutation | Average:31.14; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg1224749159 | A -> G | LOC_Os12g40010.1 | downstream_gene_variant ; 3377.0bp to feature; MODIFIER | silent_mutation | Average:31.14; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg1224749159 | A -> G | LOC_Os12g40020.1 | downstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:31.14; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg1224749159 | A -> G | LOC_Os12g40010.2 | downstream_gene_variant ; 2615.0bp to feature; MODIFIER | silent_mutation | Average:31.14; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg1224749159 | A -> G | LOC_Os12g40020-LOC_Os12g40030 | intergenic_region ; MODIFIER | silent_mutation | Average:31.14; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224749159 | NA | 1.96E-39 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | NA | 1.78E-21 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | 3.30E-10 | 4.14E-92 | mr1334 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | 5.11E-07 | 1.42E-19 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | NA | 8.34E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | NA | 3.23E-22 | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | 2.75E-11 | 4.49E-101 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | 2.64E-09 | 6.26E-26 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | NA | 3.30E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | NA | 6.59E-51 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224749159 | 2.83E-06 | 7.50E-12 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |