\
| Variant ID: vg1224719973 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24719973 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 105. )
CCATTTTTTTTTTCAAAAACATCACATTAAATCTTTAAGCACATACATGGAGCACTAAATATAGATTAAAAAAACTAATTGCACAGTTATATGAGAAATC[A/G]
CGAGACGAATCTTTTGAGCCTAATTAGTCCATGATAGCCATAAATGCTACAATAACACACATGTACTAATGATGGATTAATTAGGCTCAAAAGATTCGTC
GACGAATCTTTTGAGCCTAATTAATCCATCATTAGTACATGTGTGTTATTGTAGCATTTATGGCTATCATGGACTAATTAGGCTCAAAAGATTCGTCTCG[T/C]
GATTTCTCATATAACTGTGCAATTAGTTTTTTTAATCTATATTTAGTGCTCCATGTATGTGCTTAAAGATTTAATGTGATGTTTTTGAAAAAAAAAATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 27.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 22.90% | 77.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.90% | 96.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.70% | 42.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.80% | 88.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224719973 | A -> G | LOC_Os12g39980.1 | upstream_gene_variant ; 671.0bp to feature; MODIFIER | silent_mutation | Average:52.907; most accessible tissue: Callus, score: 79.78 | N | N | N | N |
| vg1224719973 | A -> G | LOC_Os12g39990.1 | downstream_gene_variant ; 3817.0bp to feature; MODIFIER | silent_mutation | Average:52.907; most accessible tissue: Callus, score: 79.78 | N | N | N | N |
| vg1224719973 | A -> G | LOC_Os12g39980-LOC_Os12g39990 | intergenic_region ; MODIFIER | silent_mutation | Average:52.907; most accessible tissue: Callus, score: 79.78 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224719973 | NA | 5.56E-13 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1224719973 | NA | 1.34E-39 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 1.64E-21 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | 3.73E-08 | 7.08E-95 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 5.40E-18 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 2.64E-21 | mr1584 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 3.42E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 6.06E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 6.41E-06 | mr1903 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 3.05E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 1.13E-22 | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | 4.11E-13 | 2.54E-109 | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | 7.84E-08 | 1.27E-24 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 8.26E-23 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 2.29E-21 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 8.21E-40 | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | NA | 1.55E-40 | mr1862_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | 4.44E-06 | 3.97E-55 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224719973 | 6.11E-06 | 3.38E-11 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |