Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1224719973:

Variant ID: vg1224719973 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24719973
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CCATTTTTTTTTTCAAAAACATCACATTAAATCTTTAAGCACATACATGGAGCACTAAATATAGATTAAAAAAACTAATTGCACAGTTATATGAGAAATC[A/G]
CGAGACGAATCTTTTGAGCCTAATTAGTCCATGATAGCCATAAATGCTACAATAACACACATGTACTAATGATGGATTAATTAGGCTCAAAAGATTCGTC

Reverse complement sequence

GACGAATCTTTTGAGCCTAATTAATCCATCATTAGTACATGTGTGTTATTGTAGCATTTATGGCTATCATGGACTAATTAGGCTCAAAAGATTCGTCTCG[T/C]
GATTTCTCATATAACTGTGCAATTAGTTTTTTTAATCTATATTTAGTGCTCCATGTATGTGCTTAAAGATTTAATGTGATGTTTTTGAAAAAAAAAATGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.90%	27.10%	0.02%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	22.90%	77.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	3.90%	96.10%	0.00%	0.00%	NA
Tropical Japonica	504	57.70%	42.30%	0.00%	0.00%	NA
Japonica Intermediate	241	10.80%	88.80%	0.41%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224719973	A -> G	LOC_Os12g39980.1	upstream_gene_variant ; 671.0bp to feature; MODIFIER	silent_mutation	Average:52.907; most accessible tissue: Callus, score: 79.78	N	N	N	N
vg1224719973	A -> G	LOC_Os12g39990.1	downstream_gene_variant ; 3817.0bp to feature; MODIFIER	silent_mutation	Average:52.907; most accessible tissue: Callus, score: 79.78	N	N	N	N
vg1224719973	A -> G	LOC_Os12g39980-LOC_Os12g39990	intergenic_region ; MODIFIER	silent_mutation	Average:52.907; most accessible tissue: Callus, score: 79.78	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224719973	NA	5.56E-13	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1224719973	NA	1.34E-39	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	1.64E-21	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	3.73E-08	7.08E-95	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	5.40E-18	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	2.64E-21	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	3.42E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	6.06E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	6.41E-06	mr1903	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	3.05E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	1.13E-22	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	4.11E-13	2.54E-109	mr1334_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	7.84E-08	1.27E-24	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	8.26E-23	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	2.29E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	8.21E-40	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	NA	1.55E-40	mr1862_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	4.44E-06	3.97E-55	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224719973	6.11E-06	3.38E-11	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251