Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1224029750:

Variant ID: vg1224029750 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24029750
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGCTCTCTGAGAAGATTCAAGATGTTTCATATGTGTCCGGATAGCCCAAAGTCTCGATAGTTAGCTCTAGGTCTTCCAGTCAATAGGCAGTTCAAAAT[G/A]
TTGACCTATTTGGGAATCTCCGGATCTATGATTATTTTCAACTCCCCAAAGCATTTCGTCTCTTGCTACGTCCTTCCTCGTCTCTGGGTACCTAGGTATC

Reverse complement sequence

GATACCTAGGTACCCAGAGACGAGGAAGGACGTAGCAAGAGACGAAATGCTTTGGGGAGTTGAAAATAATCATAGATCCGGAGATTCCCAAATAGGTCAA[C/T]
ATTTTGAACTGCCTATTGACTGGAAGACCTAGAGCTAACTATCGAGACTTTGGGCTATCCGGACACATATGAAACATCTTGAATCTTCTCAGAGAGCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.80% 0.06% 0.00% NA
All Indica  2759 77.80% 22.10% 0.07% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 8.60% 91.10% 0.37% 0.00% NA
Indica I  595 74.80% 25.00% 0.17% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 81.10% 18.80% 0.11% 0.00% NA
Indica Intermediate  786 67.30% 32.70% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224029750 G -> A LOC_Os12g39070.1 upstream_gene_variant ; 1625.0bp to feature; MODIFIER silent_mutation Average:77.085; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1224029750 G -> A LOC_Os12g39060.1 downstream_gene_variant ; 233.0bp to feature; MODIFIER silent_mutation Average:77.085; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg1224029750 G -> A LOC_Os12g39060-LOC_Os12g39070 intergenic_region ; MODIFIER silent_mutation Average:77.085; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224029750 NA 3.76E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 1.79E-09 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 3.70E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 2.90E-08 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 1.36E-21 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 3.79E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 1.32E-10 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 5.48E-07 5.48E-07 mr1160 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 1.43E-08 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 5.25E-06 mr1311 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 5.87E-06 mr1314 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 6.86E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 1.77E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 2.20E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 2.81E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 5.91E-06 5.90E-06 mr1459 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 2.26E-06 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 2.10E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 4.36E-09 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 1.23E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 1.45E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 4.38E-14 mr1730 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 1.06E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 4.30E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 2.32E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224029750 NA 4.86E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251