\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224023966:

Variant ID: vg1224023966 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24023966
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCATGTAGTAATGATTTGAATGATGGTCCTGAGTAATGTAAGGTTGTGCTGTGTTTAATTCACATTAAAATTGCAAGTTTGGTCGAAACTGAAACGAT[A/G]
TGTCGGAAAAGTTGAAAATTTGTGTGTGCAGAAAAGTTTTAATGTGATAAAAAAGTTAGAAGTTTAAAAAATTATTTTGGAAGTAAGCACGGCGATAGAA

Reverse complement sequence

TTCTATCGCCGTGCTTACTTCCAAAATAATTTTTTAAACTTCTAACTTTTTTATCACATTAAAACTTTTCTGCACACACAAATTTTCAACTTTTCCGACA[T/C]
ATCGTTTCAGTTTCGACCAAACTTGCAATTTTAATGTGAATTAAACACAGCACAACCTTACATTACTCAGGACCATCATTCAAATCATTACTACATGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.40% 0.08% 0.00% NA
All Indica  2759 44.90% 54.90% 0.14% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 11.20% 88.80% 0.00% 0.00% NA
Indica I  595 88.60% 11.30% 0.17% 0.00% NA
Indica II  465 25.60% 74.00% 0.43% 0.00% NA
Indica III  913 22.90% 77.00% 0.11% 0.00% NA
Indica Intermediate  786 48.90% 51.10% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224023966 A -> G LOC_Os12g39040-LOC_Os12g39060 intergenic_region ; MODIFIER silent_mutation Average:41.157; most accessible tissue: Callus, score: 67.968 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224023966 NA 4.75E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 1.74E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 3.28E-07 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 1.69E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 4.44E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 9.16E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 2.47E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 6.45E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 6.42E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 3.77E-08 mr1607_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 8.06E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 4.24E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 9.02E-08 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023966 NA 7.52E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251