Variant ID: vg1223993351 (JBrowse) | Variation Type: INDEL |
Chromosome: chr12 | Position: 23993351 |
Reference Allele: CGCTAGCTA | Alternative Allele: TGCTAGCTA,C |
Primary Allele: CGCTAGCTA | Secondary Allele: TGCTAGCTA |
Inferred Ancestral Allele: Not determined.
CATATCGCAATTTACAGGTGGATTTTATAATTTGTTTTGTTATTAGGCTACGTTAAATACTTCAAACGTATATCCGATGTGACACGGCAAAAATTTTTAC[CGCTAGCTA/TGCTAGCTA,C]
GCTGGATCTAAACACAGCGTTAACCATATAAAATTCCACAAAACTCCTACCCCCCCCCCCCCCCCCCGCGTTCTACTAATCGCAGTCGCATCCAAAGGTT
AACCTTTGGATGCGACTGCGATTAGTAGAACGCGGGGGGGGGGGGGGGGGGTAGGAGTTTTGTGGAATTTTATATGGTTAACGCTGTGTTTAGATCCAGC[TAGCTAGCG/TAGCTAGCA,G]
GTAAAAATTTTTGCCGTGTCACATCGGATATACGTTTGAAGTATTTAACGTAGCCTAATAACAAAACAAATTATAAAATCCACCTGTAAATTGCGATATG
Populations | Population Size | Frequency of CGCTAGCTA(primary allele) | Frequency of TGCTAGCTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 59.30% | 6.50% | 0.51% | 33.64% | C: 0.08% |
All Indica | 2759 | 48.10% | 3.60% | 0.76% | 47.52% | C: 0.07% |
All Japonica | 1512 | 89.20% | 10.20% | 0.07% | 0.53% | NA |
Aus | 269 | 8.20% | 1.10% | 0.74% | 89.96% | NA |
Indica I | 595 | 55.60% | 1.00% | 0.50% | 42.86% | NA |
Indica II | 465 | 70.80% | 2.60% | 0.43% | 26.02% | C: 0.22% |
Indica III | 913 | 31.30% | 3.20% | 0.66% | 64.84% | NA |
Indica Intermediate | 786 | 48.30% | 6.60% | 1.27% | 43.64% | C: 0.13% |
Temperate Japonica | 767 | 90.20% | 9.30% | 0.13% | 0.39% | NA |
Tropical Japonica | 504 | 94.60% | 4.60% | 0.00% | 0.79% | NA |
Japonica Intermediate | 241 | 74.70% | 24.90% | 0.00% | 0.41% | NA |
VI/Aromatic | 96 | 45.80% | 44.80% | 0.00% | 9.38% | NA |
Intermediate | 90 | 68.90% | 6.70% | 0.00% | 22.22% | C: 2.22% |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1223993351 | CGCTAGCTA -> TGCTAGCTA | LOC_Os12g39010.1 | upstream_gene_variant ; 381.0bp to feature; MODIFIER | silent_mutation | Average:44.713; most accessible tissue: Minghui63 root, score: 85.669 | N | N | N | N |
vg1223993351 | CGCTAGCTA -> TGCTAGCTA | LOC_Os12g39000-LOC_Os12g39010 | intergenic_region ; MODIFIER | silent_mutation | Average:44.713; most accessible tissue: Minghui63 root, score: 85.669 | N | N | N | N |
vg1223993351 | CGCTAGCTA -> DEL | N | N | silent_mutation | Average:44.713; most accessible tissue: Minghui63 root, score: 85.669 | N | N | N | N |
vg1223993351 | CGCTAGCTA -> C | LOC_Os12g39010.1 | upstream_gene_variant ; 380.0bp to feature; MODIFIER | silent_mutation | Average:44.713; most accessible tissue: Minghui63 root, score: 85.669 | N | N | N | N |
vg1223993351 | CGCTAGCTA -> C | LOC_Os12g39000-LOC_Os12g39010 | intergenic_region ; MODIFIER | silent_mutation | Average:44.713; most accessible tissue: Minghui63 root, score: 85.669 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1223993351 | 6.62E-06 | 6.61E-06 | mr1038 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1223993351 | NA | 1.43E-06 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1223993351 | NA | 1.87E-06 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1223993351 | 4.69E-06 | NA | mr1350_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |