\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223869700:

Variant ID: vg1223869700 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23869700
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTCCATGCACACGTGCATCTTGTCCACTTTCTTCTCTCCACCAACAAAAGGGAGGCCAGAAGTTATGCATGCATGAAAGGTGAACAAAGTGCACCACCC[G/A]
GCTATTTTGTGCTCAATAGCTGAATATGAATAATTACTCGAGTGTACAAATGAATTAATTTACTATTATATTTATTAAAAAAGAGATTTAAATAGAATTC

Reverse complement sequence

GAATTCTATTTAAATCTCTTTTTTAATAAATATAATAGTAAATTAATTCATTTGTACACTCGAGTAATTATTCATATTCAGCTATTGAGCACAAAATAGC[C/T]
GGGTGGTGCACTTTGTTCACCTTTCATGCATGCATAACTTCTGGCCTCCCTTTTGTTGGTGGAGAGAAGAAAGTGGACAAGATGCACGTGTGCATGGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 2.40% 0.40% 6.62% NA
All Indica  2759 92.80% 0.10% 0.11% 7.00% NA
All Japonica  1512 84.10% 7.30% 0.99% 7.54% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 72.50% 0.00% 0.65% 26.88% NA
Indica III  913 99.70% 0.00% 0.00% 0.33% NA
Indica Intermediate  786 91.60% 0.30% 0.00% 8.14% NA
Temperate Japonica  767 93.90% 2.30% 1.04% 2.74% NA
Tropical Japonica  504 79.80% 4.80% 0.60% 14.88% NA
Japonica Intermediate  241 62.20% 28.60% 1.66% 7.47% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 1.10% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223869700 G -> DEL N N silent_mutation Average:35.175; most accessible tissue: Callus, score: 81.412 N N N N
vg1223869700 G -> A LOC_Os12g38840.1 upstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:35.175; most accessible tissue: Callus, score: 81.412 N N N N
vg1223869700 G -> A LOC_Os12g38840-LOC_Os12g38850 intergenic_region ; MODIFIER silent_mutation Average:35.175; most accessible tissue: Callus, score: 81.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223869700 NA 2.47E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 3.32E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 2.41E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 2.84E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 8.89E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 3.65E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 7.41E-08 1.86E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 8.52E-06 1.23E-07 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 1.98E-08 1.04E-13 mr1693 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 7.27E-06 3.74E-07 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 5.11E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 9.68E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 1.23E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 3.49E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 1.38E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 1.75E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 7.60E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 8.26E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 3.13E-08 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 4.63E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 4.99E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 3.35E-06 2.21E-10 mr1691_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 9.61E-08 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 4.61E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700 NA 3.33E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251