Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223869700:

Variant ID: vg1223869700 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23869700
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTCCATGCACACGTGCATCTTGTCCACTTTCTTCTCTCCACCAACAAAAGGGAGGCCAGAAGTTATGCATGCATGAAAGGTGAACAAAGTGCACCACCC[G/A]
GCTATTTTGTGCTCAATAGCTGAATATGAATAATTACTCGAGTGTACAAATGAATTAATTTACTATTATATTTATTAAAAAAGAGATTTAAATAGAATTC

Reverse complement sequence

GAATTCTATTTAAATCTCTTTTTTAATAAATATAATAGTAAATTAATTCATTTGTACACTCGAGTAATTATTCATATTCAGCTATTGAGCACAAAATAGC[C/T]
GGGTGGTGCACTTTGTTCACCTTTCATGCATGCATAACTTCTGGCCTCCCTTTTGTTGGTGGAGAGAAGAAAGTGGACAAGATGCACGTGTGCATGGACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	2.40%	0.40%	6.62%	NA
All Indica	2759	92.80%	0.10%	0.11%	7.00%	NA
All Japonica	1512	84.10%	7.30%	0.99%	7.54%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	72.50%	0.00%	0.65%	26.88%	NA
Indica III	913	99.70%	0.00%	0.00%	0.33%	NA
Indica Intermediate	786	91.60%	0.30%	0.00%	8.14%	NA
Temperate Japonica	767	93.90%	2.30%	1.04%	2.74%	NA
Tropical Japonica	504	79.80%	4.80%	0.60%	14.88%	NA
Japonica Intermediate	241	62.20%	28.60%	1.66%	7.47%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	1.10%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223869700	G -> DEL	N	N	silent_mutation	Average:35.175; most accessible tissue: Callus, score: 81.412	N	N	N	N
vg1223869700	G -> A	LOC_Os12g38840.1	upstream_gene_variant ; 3254.0bp to feature; MODIFIER	silent_mutation	Average:35.175; most accessible tissue: Callus, score: 81.412	N	N	N	N
vg1223869700	G -> A	LOC_Os12g38840-LOC_Os12g38850	intergenic_region ; MODIFIER	silent_mutation	Average:35.175; most accessible tissue: Callus, score: 81.412	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223869700	NA	2.47E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	3.32E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	2.41E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	2.84E-07	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	8.89E-07	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	3.65E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	7.41E-08	1.86E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	8.52E-06	1.23E-07	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	1.98E-08	1.04E-13	mr1693	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	7.27E-06	3.74E-07	mr1720	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	5.11E-06	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	9.68E-07	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	1.23E-08	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	3.49E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	1.38E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	1.75E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	7.60E-07	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	8.26E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	3.13E-08	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	4.63E-07	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	4.99E-08	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	3.35E-06	2.21E-10	mr1691_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	9.61E-08	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	4.61E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869700	NA	3.33E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251