\
| Variant ID: vg1223766180 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23766180 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 107. )
GGACCAAACATCACAGGCGCGACTTGGGAACTAGGCCGAAACCCTAAAACTCATCGTAGCCGGCTTGCTCCTGGAAGAACTCCTCATCAGTAGGATCCGC[C/T]
TCATCTTCTTCAGCAACTGGGGGGGATTATTTATATAGAGCAAGGGTGAGTACGGGAGTACTCAGCAAGCCATGGGAAATAAGTGTTTAATGCAGGCTTC
GAAGCCTGCATTAAACACTTATTTCCCATGGCTTGCTGAGTACTCCCGTACTCACCCTTGCTCTATATAAATAATCCCCCCCAGTTGCTGAAGAAGATGA[G/A]
GCGGATCCTACTGATGAGGAGTTCTTCCAGGAGCAAGCCGGCTACGATGAGTTTTAGGGTTTCGGCCTAGTTCCCAAGTCGCGCCTGTGATGTTTGGTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 0.60% | 17.25% | 30.62% | NA |
| All Indica | 2759 | 37.70% | 0.40% | 19.64% | 42.19% | NA |
| All Japonica | 1512 | 81.00% | 0.00% | 1.72% | 17.33% | NA |
| Aus | 269 | 10.00% | 5.90% | 82.53% | 1.49% | NA |
| Indica I | 595 | 15.50% | 0.20% | 14.96% | 69.41% | NA |
| Indica II | 465 | 28.00% | 0.20% | 26.88% | 44.95% | NA |
| Indica III | 913 | 53.20% | 0.40% | 16.32% | 30.01% | NA |
| Indica Intermediate | 786 | 42.40% | 0.80% | 22.77% | 34.10% | NA |
| Temperate Japonica | 767 | 88.70% | 0.00% | 0.91% | 10.43% | NA |
| Tropical Japonica | 504 | 77.00% | 0.00% | 2.78% | 20.24% | NA |
| Japonica Intermediate | 241 | 64.70% | 0.00% | 2.07% | 33.20% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 8.33% | 2.08% | NA |
| Intermediate | 90 | 64.40% | 0.00% | 18.89% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223766180 | C -> DEL | N | N | silent_mutation | Average:32.779; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg1223766180 | C -> T | LOC_Os12g38690.1 | upstream_gene_variant ; 3610.0bp to feature; MODIFIER | silent_mutation | Average:32.779; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg1223766180 | C -> T | LOC_Os12g38690-LOC_Os12g38700 | intergenic_region ; MODIFIER | silent_mutation | Average:32.779; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223766180 | NA | 8.58E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | NA | 6.88E-09 | mr1193 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | 2.24E-06 | 2.24E-06 | mr1750 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | 7.79E-06 | 3.57E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | 5.25E-06 | 1.31E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | NA | 8.53E-06 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | NA | 2.76E-11 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | 8.22E-06 | 1.90E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | 7.97E-06 | NA | mr1381_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | NA | 5.35E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | NA | 5.19E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | NA | 1.30E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | NA | 1.39E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223766180 | NA | 1.91E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |