\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223653374:

Variant ID: vg1223653374 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23653374
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCAACTTGAACCACATTAAACTGAGTTATAATGAATTAGTTATGAATTTTTAAAGATTAAATCGGATTAAAACACTTATATGGATTTTAATTGAATTA[C/T]
GACGCAATAATGAATTATTTTTGAAAAGGAAAAGGAGGATTATTGCGTCAGCGGCTAGGATTTCGCGGTGGACCGGGTGCACGGCAGCGGTTCACGGGAA

Reverse complement sequence

TTCCCGTGAACCGCTGCCGTGCACCCGGTCCACCGCGAAATCCTAGCCGCTGACGCAATAATCCTCCTTTTCCTTTTCAAAAATAATTCATTATTGCGTC[G/A]
TAATTCAATTAAAATCCATATAAGTGTTTTAATCCGATTTAATCTTTAAAAATTCATAACTAATTCATTATAACTCAGTTTAATGTGGTTCAAGTTGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 34.10% 15.68% 13.18% NA
All Indica  2759 3.20% 52.50% 22.11% 22.22% NA
All Japonica  1512 99.10% 0.40% 0.33% 0.20% NA
Aus  269 10.40% 48.00% 41.64% 0.00% NA
Indica I  595 1.30% 43.50% 28.40% 26.72% NA
Indica II  465 4.50% 44.70% 22.80% 27.96% NA
Indica III  913 2.40% 66.20% 15.22% 16.21% NA
Indica Intermediate  786 4.70% 48.00% 24.94% 22.39% NA
Temperate Japonica  767 99.10% 0.50% 0.39% 0.00% NA
Tropical Japonica  504 98.80% 0.20% 0.40% 0.60% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 6.20% 5.21% 0.00% NA
Intermediate  90 58.90% 23.30% 10.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223653374 C -> DEL N N silent_mutation Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1223653374 C -> T LOC_Os12g38500.1 downstream_gene_variant ; 3172.0bp to feature; MODIFIER silent_mutation Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1223653374 C -> T LOC_Os12g38510.1 downstream_gene_variant ; 1907.0bp to feature; MODIFIER silent_mutation Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1223653374 C -> T LOC_Os12g38520.1 downstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1223653374 C -> T LOC_Os12g38510-LOC_Os12g38520 intergenic_region ; MODIFIER silent_mutation Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223653374 NA 3.71E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223653374 NA 1.11E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223653374 NA 6.45E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223653374 NA 8.34E-08 mr1448_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223653374 NA 9.46E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251