Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1223653374:

Variant ID: vg1223653374 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23653374
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCAACTTGAACCACATTAAACTGAGTTATAATGAATTAGTTATGAATTTTTAAAGATTAAATCGGATTAAAACACTTATATGGATTTTAATTGAATTA[C/T]
GACGCAATAATGAATTATTTTTGAAAAGGAAAAGGAGGATTATTGCGTCAGCGGCTAGGATTTCGCGGTGGACCGGGTGCACGGCAGCGGTTCACGGGAA

Reverse complement sequence

TTCCCGTGAACCGCTGCCGTGCACCCGGTCCACCGCGAAATCCTAGCCGCTGACGCAATAATCCTCCTTTTCCTTTTCAAAAATAATTCATTATTGCGTC[G/A]
TAATTCAATTAAAATCCATATAAGTGTTTTAATCCGATTTAATCTTTAAAAATTCATAACTAATTCATTATAACTCAGTTTAATGTGGTTCAAGTTGCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.10%	34.10%	15.68%	13.18%	NA
All Indica	2759	3.20%	52.50%	22.11%	22.22%	NA
All Japonica	1512	99.10%	0.40%	0.33%	0.20%	NA
Aus	269	10.40%	48.00%	41.64%	0.00%	NA
Indica I	595	1.30%	43.50%	28.40%	26.72%	NA
Indica II	465	4.50%	44.70%	22.80%	27.96%	NA
Indica III	913	2.40%	66.20%	15.22%	16.21%	NA
Indica Intermediate	786	4.70%	48.00%	24.94%	22.39%	NA
Temperate Japonica	767	99.10%	0.50%	0.39%	0.00%	NA
Tropical Japonica	504	98.80%	0.20%	0.40%	0.60%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	6.20%	5.21%	0.00%	NA
Intermediate	90	58.90%	23.30%	10.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223653374	C -> DEL	N	N	silent_mutation	Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg1223653374	C -> T	LOC_Os12g38500.1	downstream_gene_variant ; 3172.0bp to feature; MODIFIER	silent_mutation	Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg1223653374	C -> T	LOC_Os12g38510.1	downstream_gene_variant ; 1907.0bp to feature; MODIFIER	silent_mutation	Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg1223653374	C -> T	LOC_Os12g38520.1	downstream_gene_variant ; 3003.0bp to feature; MODIFIER	silent_mutation	Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg1223653374	C -> T	LOC_Os12g38510-LOC_Os12g38520	intergenic_region ; MODIFIER	silent_mutation	Average:38.719; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223653374	NA	3.71E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223653374	NA	1.11E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223653374	NA	6.45E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223653374	NA	8.34E-08	mr1448_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223653374	NA	9.46E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251