\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223570557:

Variant ID: vg1223570557 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23570557
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, T: 0.27, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGCATCATGGTGTTGATACACGTAGTATGTACTTCCTCTGTTTCACAATATAAGACTTTCTAACATCAGTGGCGTAACTAGGATTTAAAGTAAAAGTG[T/G]
TTCATCTATATGTAATATGTCAATTAAAAGGGTGGTCCACTATATAATTTTTACTATATTAACTAGCACATATACTATAATTTCAAATTTTTAGGTGGTC

Reverse complement sequence

GACCACCTAAAAATTTGAAATTATAGTATATGTGCTAGTTAATATAGTAAAAATTATATAGTGGACCACCCTTTTAATTGACATATTACATATAGATGAA[A/C]
CACTTTTACTTTAAATCCTAGTTACGCCACTGATGTTAGAAAGTCTTATATTGTGAAACAGAGGAAGTACATACTACGTGTATCAACACCATGATGCACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 18.80% 0.06% 0.32% NA
All Indica  2759 98.50% 1.30% 0.04% 0.11% NA
All Japonica  1512 46.50% 52.80% 0.07% 0.66% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 98.90% 1.00% 0.00% 0.11% NA
Indica Intermediate  786 97.50% 2.20% 0.13% 0.25% NA
Temperate Japonica  767 58.30% 40.50% 0.13% 1.04% NA
Tropical Japonica  504 21.80% 77.80% 0.00% 0.40% NA
Japonica Intermediate  241 60.60% 39.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 58.90% 37.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223570557 T -> DEL N N silent_mutation Average:73.762; most accessible tissue: Minghui63 panicle, score: 92.078 N N N N
vg1223570557 T -> G LOC_Os12g38400-LOC_Os12g38410 intergenic_region ; MODIFIER silent_mutation Average:73.762; most accessible tissue: Minghui63 panicle, score: 92.078 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1223570557 T G 0.07 0.02 0.01 0.09 0.06 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223570557 9.83E-06 NA Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1223570557 NA 1.97E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 1.65E-17 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 4.20E-27 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 2.36E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 6.24E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 3.12E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 2.15E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 1.29E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 2.49E-16 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 4.28E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 3.35E-17 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 4.02E-19 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 8.33E-27 mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 1.92E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 5.90E-25 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 1.15E-16 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 1.62E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 1.23E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 3.88E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223570557 NA 6.56E-16 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251