\
| Variant ID: vg1223453821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23453821 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGTTAGAGAGATAATTCCACACGCTGGTCCTCGAACCAGCAAACCCGTAGCAATCTCTCACACCGCGACTTCCATTGGTGCTAGAGAGATAATTCTACG[C/T]
GCTGGTTCTCGAACCAGTAAACCCGTAGCAATCGCTCACACCGTGACTTCCATTGGTGCTAGAGAGATAATTCTATGCGCTGGTCCTCGAACCAGCAAAC
GTTTGCTGGTTCGAGGACCAGCGCATAGAATTATCTCTCTAGCACCAATGGAAGTCACGGTGTGAGCGATTGCTACGGGTTTACTGGTTCGAGAACCAGC[G/A]
CGTAGAATTATCTCTCTAGCACCAATGGAAGTCGCGGTGTGAGAGATTGCTACGGGTTTGCTGGTTCGAGGACCAGCGTGTGGAATTATCTCTCTAACAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 28.90% | 3.39% | 5.35% | NA |
| All Indica | 2759 | 87.50% | 2.80% | 0.80% | 8.92% | NA |
| All Japonica | 1512 | 18.90% | 72.40% | 8.33% | 0.40% | NA |
| Aus | 269 | 69.10% | 27.90% | 2.97% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 58.70% | 4.30% | 2.15% | 34.84% | NA |
| Indica III | 913 | 97.40% | 1.50% | 0.00% | 1.10% | NA |
| Indica Intermediate | 786 | 85.50% | 3.60% | 1.53% | 9.41% | NA |
| Temperate Japonica | 767 | 31.80% | 55.90% | 11.47% | 0.78% | NA |
| Tropical Japonica | 504 | 2.60% | 93.80% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 79.70% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 87.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 54.40% | 41.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223453821 | C -> DEL | LOC_Os12g38190.1 | N | frameshift_variant | Average:23.608; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg1223453821 | C -> T | LOC_Os12g38190.1 | synonymous_variant ; p.Arg307Arg; LOW | synonymous_codon | Average:23.608; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223453821 | NA | 3.90E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | NA | 2.98E-08 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | NA | 2.68E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | NA | 1.38E-13 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | NA | 1.32E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | 9.36E-06 | 6.81E-07 | mr1582 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | 3.49E-06 | 2.42E-06 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | 6.16E-07 | 1.35E-07 | mr1772 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | NA | 5.80E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | NA | 4.95E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223453821 | NA | 6.36E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |