\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223438680:

Variant ID: vg1223438680 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23438680
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.08, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TAGATAGTAATTTACCCGTGCTAATGCCACGACAATATTTGTTAACAAAGACCCCCCCCAAAAAAAATACACATAGCTAGAAAATAGATAAATTTATAAA[G/T]
CTAGGTGTGTAATATAACATCACATATACCTTCTTTTACTATGCAATTTGCATACAAATACTTTCGGCCAATCTCAATTTTTTCCCCTTCAGAATGAAAC

Reverse complement sequence

GTTTCATTCTGAAGGGGAAAAAATTGAGATTGGCCGAAAGTATTTGTATGCAAATTGCATAGTAAAAGAAGGTATATGTGATGTTATATTACACACCTAG[C/A]
TTTATAAATTTATCTATTTTCTAGCTATGTGTATTTTTTTTGGGGGGGGTCTTTGTTAACAAATATTGTCGTGGCATTAGCACGGGTAAATTACTATCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 42.50% 0.17% 5.92% NA
All Indica  2759 79.20% 10.60% 0.29% 9.86% NA
All Japonica  1512 0.60% 98.90% 0.00% 0.46% NA
Aus  269 71.70% 28.30% 0.00% 0.00% NA
Indica I  595 86.60% 13.10% 0.34% 0.00% NA
Indica II  465 55.70% 6.00% 0.22% 38.06% NA
Indica III  913 89.50% 9.30% 0.11% 1.10% NA
Indica Intermediate  786 75.70% 13.00% 0.51% 10.81% NA
Temperate Japonica  767 0.30% 98.80% 0.00% 0.91% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 88.50% 0.00% 1.04% NA
Intermediate  90 35.60% 64.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223438680 G -> DEL N N silent_mutation Average:73.259; most accessible tissue: Callus, score: 87.93 N N N N
vg1223438680 G -> T LOC_Os12g38180.1 upstream_gene_variant ; 3490.0bp to feature; MODIFIER silent_mutation Average:73.259; most accessible tissue: Callus, score: 87.93 N N N N
vg1223438680 G -> T LOC_Os12g38170.1 downstream_gene_variant ; 2086.0bp to feature; MODIFIER silent_mutation Average:73.259; most accessible tissue: Callus, score: 87.93 N N N N
vg1223438680 G -> T LOC_Os12g38170-LOC_Os12g38180 intergenic_region ; MODIFIER silent_mutation Average:73.259; most accessible tissue: Callus, score: 87.93 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223438680 8.06E-06 NA mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 4.44E-06 NA mr1141 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 4.59E-06 NA mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 2.33E-06 NA mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 6.40E-06 NA mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 5.71E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 5.36E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 5.36E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 1.44E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 1.97E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 6.28E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 9.00E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 4.92E-06 mr1324_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 3.24E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 1.94E-07 1.93E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 8.97E-08 1.34E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 NA 1.83E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223438680 3.22E-07 3.22E-07 mr1966_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251