\
| Variant ID: vg1223438680 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23438680 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.08, others allele: 0.00, population size: 88. )
TAGATAGTAATTTACCCGTGCTAATGCCACGACAATATTTGTTAACAAAGACCCCCCCCAAAAAAAATACACATAGCTAGAAAATAGATAAATTTATAAA[G/T]
CTAGGTGTGTAATATAACATCACATATACCTTCTTTTACTATGCAATTTGCATACAAATACTTTCGGCCAATCTCAATTTTTTCCCCTTCAGAATGAAAC
GTTTCATTCTGAAGGGGAAAAAATTGAGATTGGCCGAAAGTATTTGTATGCAAATTGCATAGTAAAAGAAGGTATATGTGATGTTATATTACACACCTAG[C/A]
TTTATAAATTTATCTATTTTCTAGCTATGTGTATTTTTTTTGGGGGGGGTCTTTGTTAACAAATATTGTCGTGGCATTAGCACGGGTAAATTACTATCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 42.50% | 0.17% | 5.92% | NA |
| All Indica | 2759 | 79.20% | 10.60% | 0.29% | 9.86% | NA |
| All Japonica | 1512 | 0.60% | 98.90% | 0.00% | 0.46% | NA |
| Aus | 269 | 71.70% | 28.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.60% | 13.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 55.70% | 6.00% | 0.22% | 38.06% | NA |
| Indica III | 913 | 89.50% | 9.30% | 0.11% | 1.10% | NA |
| Indica Intermediate | 786 | 75.70% | 13.00% | 0.51% | 10.81% | NA |
| Temperate Japonica | 767 | 0.30% | 98.80% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 35.60% | 64.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223438680 | G -> DEL | N | N | silent_mutation | Average:73.259; most accessible tissue: Callus, score: 87.93 | N | N | N | N |
| vg1223438680 | G -> T | LOC_Os12g38180.1 | upstream_gene_variant ; 3490.0bp to feature; MODIFIER | silent_mutation | Average:73.259; most accessible tissue: Callus, score: 87.93 | N | N | N | N |
| vg1223438680 | G -> T | LOC_Os12g38170.1 | downstream_gene_variant ; 2086.0bp to feature; MODIFIER | silent_mutation | Average:73.259; most accessible tissue: Callus, score: 87.93 | N | N | N | N |
| vg1223438680 | G -> T | LOC_Os12g38170-LOC_Os12g38180 | intergenic_region ; MODIFIER | silent_mutation | Average:73.259; most accessible tissue: Callus, score: 87.93 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223438680 | 8.06E-06 | NA | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | 4.44E-06 | NA | mr1141 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | 4.59E-06 | NA | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | 2.33E-06 | NA | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | 6.40E-06 | NA | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 5.71E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 5.36E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 5.36E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 1.44E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 1.97E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 6.28E-08 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 9.00E-06 | mr1321_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 4.92E-06 | mr1324_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 3.24E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | 1.94E-07 | 1.93E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | 8.97E-08 | 1.34E-08 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | NA | 1.83E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223438680 | 3.22E-07 | 3.22E-07 | mr1966_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |