\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222822194:

Variant ID: vg1222822194 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22822194
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCATTTCAATATACAATTATTAGTTGTTTCTTCTTTAGTTTTATAGTTAAATAACCCAAAAGGGTAGAGGAATGAAGAGCGTGGATTTTGAGGCACG[G/A]
AAAGGGGGTTGGTAGTTATATGCGCATGTGAGGGGTGCTGGATGTGAAGGGGACTTTGTGTTTCTAATTTTTCTAAATTATATGAGTGAAAACTAACTAT

Reverse complement sequence

ATAGTTAGTTTTCACTCATATAATTTAGAAAAATTAGAAACACAAAGTCCCCTTCACATCCAGCACCCCTCACATGCGCATATAACTACCAACCCCCTTT[C/T]
CGTGCCTCAAAATCCACGCTCTTCATTCCTCTACCCTTTTGGGTTATTTAACTATAAAACTAAAGAAGAAACAACTAATAATTGTATATTGAAATGATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 10.20% 5.71% 24.48% NA
All Indica  2759 56.30% 1.30% 4.93% 37.48% NA
All Japonica  1512 64.40% 28.20% 6.94% 0.46% NA
Aus  269 52.00% 0.70% 7.43% 39.78% NA
Indica I  595 67.60% 0.70% 13.45% 18.32% NA
Indica II  465 34.80% 2.40% 3.01% 59.78% NA
Indica III  913 63.20% 1.20% 1.53% 34.06% NA
Indica Intermediate  786 52.50% 1.10% 3.56% 42.75% NA
Temperate Japonica  767 89.70% 1.70% 8.08% 0.52% NA
Tropical Japonica  504 30.40% 64.50% 4.76% 0.40% NA
Japonica Intermediate  241 54.80% 36.90% 7.88% 0.41% NA
VI/Aromatic  96 94.80% 1.00% 1.04% 3.12% NA
Intermediate  90 67.80% 16.70% 8.89% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222822194 G -> DEL N N silent_mutation Average:23.503; most accessible tissue: Callus, score: 63.145 N N N N
vg1222822194 G -> A LOC_Os12g37200.1 downstream_gene_variant ; 1200.0bp to feature; MODIFIER silent_mutation Average:23.503; most accessible tissue: Callus, score: 63.145 N N N N
vg1222822194 G -> A LOC_Os12g37210.1 downstream_gene_variant ; 2386.0bp to feature; MODIFIER silent_mutation Average:23.503; most accessible tissue: Callus, score: 63.145 N N N N
vg1222822194 G -> A LOC_Os12g37200-LOC_Os12g37210 intergenic_region ; MODIFIER silent_mutation Average:23.503; most accessible tissue: Callus, score: 63.145 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222822194 NA 9.63E-06 mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 1.11E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 1.53E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 3.86E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 4.24E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 5.19E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 3.68E-06 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 1.42E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 1.04E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 1.61E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 1.50E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 1.26E-08 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 9.30E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 3.97E-09 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 1.70E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 1.42E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 5.92E-06 NA mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 1.12E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 7.32E-10 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 2.14E-07 NA mr1233_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 8.61E-07 NA mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 1.51E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 1.80E-07 NA mr1404_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 5.71E-06 5.85E-09 mr1404_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 3.91E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 8.42E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 2.82E-07 NA mr1620_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 3.59E-07 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 7.98E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 4.64E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222822194 NA 3.98E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251