\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222488812:

Variant ID: vg1222488812 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22488812
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTAACAACAGCCTTGCTGCTTGAATAAATGGTTGCATGCCGAAGGGAGTGGAGATTCTCCAAACCTAAATCATTTAAGCCACCCCTCCTTAGGCTGG[T/C]
CCAAATACGAAGATAAAGCCTTTCAAGGTGGGGCATAGCTCCTGGTTGAAACGATGGCATCATGGGGCTATAAAAGTGAAAATCTTTTAAACTCCGAAAT

Reverse complement sequence

ATTTCGGAGTTTAAAAGATTTTCACTTTTATAGCCCCATGATGCCATCGTTTCAACCAGGAGCTATGCCCCACCTTGAAAGGCTTTATCTTCGTATTTGG[A/G]
CCAGCCTAAGGAGGGGTGGCTTAAATGATTTAGGTTTGGAGAATCTCCACTCCCTTCGGCATGCAACCATTTATTCAAGCAGCAAGGCTGTTGTTAGAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 3.20% 4.68% 18.39% NA
All Indica  2759 67.90% 5.40% 6.23% 20.48% NA
All Japonica  1512 88.80% 0.00% 2.84% 8.40% NA
Aus  269 37.20% 0.40% 2.23% 60.22% NA
Indica I  595 78.80% 0.20% 2.69% 18.32% NA
Indica II  465 67.50% 11.00% 6.24% 15.27% NA
Indica III  913 62.30% 4.60% 8.54% 24.53% NA
Indica Intermediate  786 66.40% 6.90% 6.23% 20.48% NA
Temperate Japonica  767 93.50% 0.00% 3.52% 3.00% NA
Tropical Japonica  504 79.80% 0.00% 1.79% 18.45% NA
Japonica Intermediate  241 92.50% 0.00% 2.90% 4.56% NA
VI/Aromatic  96 94.80% 2.10% 0.00% 3.12% NA
Intermediate  90 86.70% 0.00% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222488812 T -> C LOC_Os12g36720.1 3_prime_UTR_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:48.816; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1222488812 T -> C LOC_Os12g36710.1 upstream_gene_variant ; 4208.0bp to feature; MODIFIER silent_mutation Average:48.816; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1222488812 T -> DEL N N silent_mutation Average:48.816; most accessible tissue: Minghui63 root, score: 70.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222488812 NA 2.22E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 4.81E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 6.15E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 8.80E-07 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 1.19E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 7.48E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 4.36E-06 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 3.89E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 7.89E-06 8.12E-08 mr1660 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 5.85E-06 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 4.89E-07 4.89E-07 mr1738 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 1.16E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 3.97E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 2.72E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812 NA 2.37E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251