Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222488812:

Variant ID: vg1222488812 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22488812
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCTAACAACAGCCTTGCTGCTTGAATAAATGGTTGCATGCCGAAGGGAGTGGAGATTCTCCAAACCTAAATCATTTAAGCCACCCCTCCTTAGGCTGG[T/C]
CCAAATACGAAGATAAAGCCTTTCAAGGTGGGGCATAGCTCCTGGTTGAAACGATGGCATCATGGGGCTATAAAAGTGAAAATCTTTTAAACTCCGAAAT

Reverse complement sequence

ATTTCGGAGTTTAAAAGATTTTCACTTTTATAGCCCCATGATGCCATCGTTTCAACCAGGAGCTATGCCCCACCTTGAAAGGCTTTATCTTCGTATTTGG[A/G]
CCAGCCTAAGGAGGGGTGGCTTAAATGATTTAGGTTTGGAGAATCTCCACTCCCTTCGGCATGCAACCATTTATTCAAGCAGCAAGGCTGTTGTTAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	3.20%	4.68%	18.39%	NA
All Indica	2759	67.90%	5.40%	6.23%	20.48%	NA
All Japonica	1512	88.80%	0.00%	2.84%	8.40%	NA
Aus	269	37.20%	0.40%	2.23%	60.22%	NA
Indica I	595	78.80%	0.20%	2.69%	18.32%	NA
Indica II	465	67.50%	11.00%	6.24%	15.27%	NA
Indica III	913	62.30%	4.60%	8.54%	24.53%	NA
Indica Intermediate	786	66.40%	6.90%	6.23%	20.48%	NA
Temperate Japonica	767	93.50%	0.00%	3.52%	3.00%	NA
Tropical Japonica	504	79.80%	0.00%	1.79%	18.45%	NA
Japonica Intermediate	241	92.50%	0.00%	2.90%	4.56%	NA
VI/Aromatic	96	94.80%	2.10%	0.00%	3.12%	NA
Intermediate	90	86.70%	0.00%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222488812	T -> C	LOC_Os12g36720.1	3_prime_UTR_variant ; 133.0bp to feature; MODIFIER	silent_mutation	Average:48.816; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg1222488812	T -> C	LOC_Os12g36710.1	upstream_gene_variant ; 4208.0bp to feature; MODIFIER	silent_mutation	Average:48.816; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg1222488812	T -> DEL	N	N	silent_mutation	Average:48.816; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222488812	NA	2.22E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	4.81E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	6.15E-07	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	8.80E-07	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	1.19E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	7.48E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	4.36E-06	mr1471	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	3.89E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	7.89E-06	8.12E-08	mr1660	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	5.85E-06	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	4.89E-07	4.89E-07	mr1738	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	1.16E-06	mr1804	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	3.97E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	2.72E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222488812	NA	2.37E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251