\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222455166:

Variant ID: vg1222455166 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22455166
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATGTTTTAATTGAACGATATCGTCTTTTGGCATTTCAACTCCTCGACTTCCACGATATGACCAAGAGTCCAACATATCATTTGCTAGCTTGAAGCTAT[A/G]
AAGCATACCATATGGAATATCGCTTTGAATGCCTAATTTTTATCTCCCTTGTTGGGGTTAAAACAACTAGTACCACCAGTTTTTTAATTATCTAATTTAA

Reverse complement sequence

TTAAATTAGATAATTAAAAAACTGGTGGTACTAGTTGTTTTAACCCCAACAAGGGAGATAAAAATTAGGCATTCAAAGCGATATTCCATATGGTATGCTT[T/C]
ATAGCTTCAAGCTAGCAAATGATATGTTGGACTCTTGGTCATATCGTGGAAGTCGAGGAGTTGAAATGCCAAAAGACGATATCGTTCAATTAAAACATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 12.30% 0.38% 3.55% NA
All Indica  2759 82.60% 10.80% 0.58% 6.02% NA
All Japonica  1512 93.20% 6.60% 0.07% 0.13% NA
Aus  269 67.70% 32.00% 0.37% 0.00% NA
Indica I  595 66.90% 31.80% 1.01% 0.34% NA
Indica II  465 97.80% 1.50% 0.22% 0.43% NA
Indica III  913 80.60% 5.70% 0.33% 13.36% NA
Indica Intermediate  786 87.70% 6.50% 0.76% 5.09% NA
Temperate Japonica  767 98.20% 1.60% 0.00% 0.26% NA
Tropical Japonica  504 92.10% 7.90% 0.00% 0.00% NA
Japonica Intermediate  241 79.70% 19.90% 0.41% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222455166 A -> DEL N N silent_mutation Average:45.765; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg1222455166 A -> G LOC_Os12g36670.1 upstream_gene_variant ; 2062.0bp to feature; MODIFIER silent_mutation Average:45.765; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg1222455166 A -> G LOC_Os12g36660-LOC_Os12g36670 intergenic_region ; MODIFIER silent_mutation Average:45.765; most accessible tissue: Minghui63 root, score: 72.551 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222455166 NA 1.57E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 8.52E-06 5.57E-09 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 1.15E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 1.80E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 5.42E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 1.28E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 5.22E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 2.02E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 2.28E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 3.12E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 7.37E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 9.15E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 3.63E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 1.97E-06 2.38E-10 mr1100_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 6.29E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 1.21E-08 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 5.86E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 1.37E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 1.05E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 9.39E-06 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 2.12E-07 4.32E-11 mr1613_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 1.25E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 2.95E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166 NA 3.76E-08 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251