Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222455166:

Variant ID: vg1222455166 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22455166
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATGTTTTAATTGAACGATATCGTCTTTTGGCATTTCAACTCCTCGACTTCCACGATATGACCAAGAGTCCAACATATCATTTGCTAGCTTGAAGCTAT[A/G]
AAGCATACCATATGGAATATCGCTTTGAATGCCTAATTTTTATCTCCCTTGTTGGGGTTAAAACAACTAGTACCACCAGTTTTTTAATTATCTAATTTAA

Reverse complement sequence

TTAAATTAGATAATTAAAAAACTGGTGGTACTAGTTGTTTTAACCCCAACAAGGGAGATAAAAATTAGGCATTCAAAGCGATATTCCATATGGTATGCTT[T/C]
ATAGCTTCAAGCTAGCAAATGATATGTTGGACTCTTGGTCATATCGTGGAAGTCGAGGAGTTGAAATGCCAAAAGACGATATCGTTCAATTAAAACATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	12.30%	0.38%	3.55%	NA
All Indica	2759	82.60%	10.80%	0.58%	6.02%	NA
All Japonica	1512	93.20%	6.60%	0.07%	0.13%	NA
Aus	269	67.70%	32.00%	0.37%	0.00%	NA
Indica I	595	66.90%	31.80%	1.01%	0.34%	NA
Indica II	465	97.80%	1.50%	0.22%	0.43%	NA
Indica III	913	80.60%	5.70%	0.33%	13.36%	NA
Indica Intermediate	786	87.70%	6.50%	0.76%	5.09%	NA
Temperate Japonica	767	98.20%	1.60%	0.00%	0.26%	NA
Tropical Japonica	504	92.10%	7.90%	0.00%	0.00%	NA
Japonica Intermediate	241	79.70%	19.90%	0.41%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222455166	A -> DEL	N	N	silent_mutation	Average:45.765; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg1222455166	A -> G	LOC_Os12g36670.1	upstream_gene_variant ; 2062.0bp to feature; MODIFIER	silent_mutation	Average:45.765; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg1222455166	A -> G	LOC_Os12g36660-LOC_Os12g36670	intergenic_region ; MODIFIER	silent_mutation	Average:45.765; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222455166	NA	1.57E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	8.52E-06	5.57E-09	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	1.15E-07	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	1.80E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	5.42E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	1.28E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	5.22E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	2.02E-08	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	2.28E-07	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	3.12E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	7.37E-07	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	9.15E-08	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	3.63E-07	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	1.97E-06	2.38E-10	mr1100_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	6.29E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	1.21E-08	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	5.86E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	1.37E-07	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	1.05E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	9.39E-06	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	2.12E-07	4.32E-11	mr1613_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	1.25E-06	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	2.95E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222455166	NA	3.76E-08	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251