\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222416857:

Variant ID: vg1222416857 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22416857
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, G: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AACACTTAATACTTCAAATGTGTGTCCGTATATTCGATGTGACACCCAAAATAAAAATTTTTGCCATCTAACCGGGCCTAAGACGACTGTGAACTGACCC[T/G]
GTTTAAATTCCACTCCAAAATTTTTCACCCTGTCACATCAGATGTTTGAACACCTGCATGAAGTATTAAATATGGGCTAAAAAAATAACTAATTGCATAG

Reverse complement sequence

CTATGCAATTAGTTATTTTTTTAGCCCATATTTAATACTTCATGCAGGTGTTCAAACATCTGATGTGACAGGGTGAAAAATTTTGGAGTGGAATTTAAAC[A/C]
GGGTCAGTTCACAGTCGTCTTAGGCCCGGTTAGATGGCAAAAATTTTTATTTTGGGTGTCACATCGAATATACGGACACACATTTGAAGTATTAAGTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 17.80% 0.28% 43.69% NA
All Indica  2759 9.60% 29.20% 0.33% 60.86% NA
All Japonica  1512 86.00% 0.70% 0.07% 13.16% NA
Aus  269 33.10% 4.50% 1.12% 61.34% NA
Indica I  595 10.60% 29.60% 0.17% 59.66% NA
Indica II  465 4.70% 17.20% 0.00% 78.06% NA
Indica III  913 10.30% 34.80% 0.44% 54.44% NA
Indica Intermediate  786 11.10% 29.40% 0.51% 59.03% NA
Temperate Japonica  767 91.10% 0.30% 0.13% 8.47% NA
Tropical Japonica  504 77.00% 1.20% 0.00% 21.83% NA
Japonica Intermediate  241 88.80% 1.20% 0.00% 9.96% NA
VI/Aromatic  96 92.70% 2.10% 0.00% 5.21% NA
Intermediate  90 70.00% 11.10% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222416857 T -> DEL N N silent_mutation Average:10.784; most accessible tissue: Callus, score: 29.153 N N N N
vg1222416857 T -> G LOC_Os12g36610.1 upstream_gene_variant ; 366.0bp to feature; MODIFIER silent_mutation Average:10.784; most accessible tissue: Callus, score: 29.153 N N N N
vg1222416857 T -> G LOC_Os12g36600.1 downstream_gene_variant ; 1241.0bp to feature; MODIFIER silent_mutation Average:10.784; most accessible tissue: Callus, score: 29.153 N N N N
vg1222416857 T -> G LOC_Os12g36620.1 downstream_gene_variant ; 2901.0bp to feature; MODIFIER silent_mutation Average:10.784; most accessible tissue: Callus, score: 29.153 N N N N
vg1222416857 T -> G LOC_Os12g36600-LOC_Os12g36610 intergenic_region ; MODIFIER silent_mutation Average:10.784; most accessible tissue: Callus, score: 29.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222416857 NA 3.12E-07 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 2.30E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.47E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 8.23E-06 1.22E-08 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 2.78E-08 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.90E-15 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.24E-08 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 5.62E-07 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 5.07E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.04E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 9.24E-06 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 2.69E-07 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.63E-14 mr1478 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.22E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.76E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 7.03E-06 NA mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 3.13E-06 3.13E-06 mr1738 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 5.65E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 6.90E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.56E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 6.88E-06 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 2.13E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 6.57E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 6.53E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 2.14E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 1.45E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 2.26E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 2.57E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 3.79E-07 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 4.66E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 4.46E-07 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 7.81E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 8.84E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222416857 NA 6.14E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251