\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222170941:

Variant ID: vg1222170941 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22170941
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGGGCTAGGATAGGATGTATAATAGTTATTCTATACTCACATCAAATTGGATACGGACGATATATAACAACTCAAAAACGGATGACGTATCAAAATTT[C/T]
GACAAAAAACATCTTTGATTTTTATAATAGTAGATATATGTTTGTTTTGTGTTAAAAATGCTACTATGTTTTTCTATAAACTTGGACAAACTTTAAAAAG

Reverse complement sequence

CTTTTTAAAGTTTGTCCAAGTTTATAGAAAAACATAGTAGCATTTTTAACACAAAACAAACATATATCTACTATTATAAAAATCAAAGATGTTTTTTGTC[G/A]
AAATTTTGATACGTCATCCGTTTTTGAGTTGTTATATATCGTCCGTATCCAATTTGATGTGAGTATAGAATAACTATTATACATCCTATCCTAGCCCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 2.20% 6.58% 2.20% NA
All Indica  2759 83.60% 3.70% 9.06% 3.62% NA
All Japonica  1512 95.80% 0.00% 3.90% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.90% 7.10% 9.08% 0.00% NA
Indica II  465 71.80% 0.60% 12.47% 15.05% NA
Indica III  913 93.40% 2.10% 3.72% 0.77% NA
Indica Intermediate  786 79.00% 4.80% 13.23% 2.93% NA
Temperate Japonica  767 93.40% 0.00% 6.13% 0.52% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 0.00% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222170941 C -> DEL N N silent_mutation Average:43.615; most accessible tissue: Callus, score: 76.834 N N N N
vg1222170941 C -> T LOC_Os12g36170.1 upstream_gene_variant ; 1121.0bp to feature; MODIFIER silent_mutation Average:43.615; most accessible tissue: Callus, score: 76.834 N N N N
vg1222170941 C -> T LOC_Os12g36180.1 downstream_gene_variant ; 2341.0bp to feature; MODIFIER silent_mutation Average:43.615; most accessible tissue: Callus, score: 76.834 N N N N
vg1222170941 C -> T LOC_Os12g36170-LOC_Os12g36180 intergenic_region ; MODIFIER silent_mutation Average:43.615; most accessible tissue: Callus, score: 76.834 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222170941 NA 8.73E-07 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941 NA 2.21E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941 NA 2.55E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941 NA 9.25E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941 NA 5.70E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941 3.98E-07 1.03E-11 mr1676_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251