\
| Variant ID: vg1222170941 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22170941 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTGGGCTAGGATAGGATGTATAATAGTTATTCTATACTCACATCAAATTGGATACGGACGATATATAACAACTCAAAAACGGATGACGTATCAAAATTT[C/T]
GACAAAAAACATCTTTGATTTTTATAATAGTAGATATATGTTTGTTTTGTGTTAAAAATGCTACTATGTTTTTCTATAAACTTGGACAAACTTTAAAAAG
CTTTTTAAAGTTTGTCCAAGTTTATAGAAAAACATAGTAGCATTTTTAACACAAAACAAACATATATCTACTATTATAAAAATCAAAGATGTTTTTTGTC[G/A]
AAATTTTGATACGTCATCCGTTTTTGAGTTGTTATATATCGTCCGTATCCAATTTGATGTGAGTATAGAATAACTATTATACATCCTATCCTAGCCCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 2.20% | 6.58% | 2.20% | NA |
| All Indica | 2759 | 83.60% | 3.70% | 9.06% | 3.62% | NA |
| All Japonica | 1512 | 95.80% | 0.00% | 3.90% | 0.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.90% | 7.10% | 9.08% | 0.00% | NA |
| Indica II | 465 | 71.80% | 0.60% | 12.47% | 15.05% | NA |
| Indica III | 913 | 93.40% | 2.10% | 3.72% | 0.77% | NA |
| Indica Intermediate | 786 | 79.00% | 4.80% | 13.23% | 2.93% | NA |
| Temperate Japonica | 767 | 93.40% | 0.00% | 6.13% | 0.52% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.00% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222170941 | C -> DEL | N | N | silent_mutation | Average:43.615; most accessible tissue: Callus, score: 76.834 | N | N | N | N |
| vg1222170941 | C -> T | LOC_Os12g36170.1 | upstream_gene_variant ; 1121.0bp to feature; MODIFIER | silent_mutation | Average:43.615; most accessible tissue: Callus, score: 76.834 | N | N | N | N |
| vg1222170941 | C -> T | LOC_Os12g36180.1 | downstream_gene_variant ; 2341.0bp to feature; MODIFIER | silent_mutation | Average:43.615; most accessible tissue: Callus, score: 76.834 | N | N | N | N |
| vg1222170941 | C -> T | LOC_Os12g36170-LOC_Os12g36180 | intergenic_region ; MODIFIER | silent_mutation | Average:43.615; most accessible tissue: Callus, score: 76.834 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222170941 | NA | 8.73E-07 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222170941 | NA | 2.21E-06 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222170941 | NA | 2.55E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222170941 | NA | 9.25E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222170941 | NA | 5.70E-07 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222170941 | 3.98E-07 | 1.03E-11 | mr1676_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |