\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221869113:

Variant ID: vg1221869113 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21869113
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTTTTCTTCAAACTTCTAACTTTTCCATTACATTAAAATTTTTCTACACACAAACTTCCAACTTTTTCATCACATCGTTCCAATTTCAATTAAACTT[C/T]
CAATTTTGGTGTGAACTAAACACGCCCGAAGAAGAAAATACGGAGGGGCTACGGGATCACCTATACATTTATCGACAAATTTTCTCCTAAAAATTTGACA

Reverse complement sequence

TGTCAAATTTTTAGGAGAAAATTTGTCGATAAATGTATAGGTGATCCCGTAGCCCCTCCGTATTTTCTTCTTCGGGCGTGTTTAGTTCACACCAAAATTG[G/A]
AAGTTTAATTGAAATTGGAACGATGTGATGAAAAAGTTGGAAGTTTGTGTGTAGAAAAATTTTAATGTAATGGAAAAGTTAGAAGTTTGAAGAAAAAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 41.00% 0.04% 0.00% NA
All Indica  2759 72.60% 27.40% 0.07% 0.00% NA
All Japonica  1512 30.50% 69.50% 0.00% 0.00% NA
Aus  269 86.60% 13.40% 0.00% 0.00% NA
Indica I  595 97.60% 2.20% 0.17% 0.00% NA
Indica II  465 24.10% 75.90% 0.00% 0.00% NA
Indica III  913 82.70% 17.30% 0.00% 0.00% NA
Indica Intermediate  786 70.50% 29.40% 0.13% 0.00% NA
Temperate Japonica  767 15.90% 84.10% 0.00% 0.00% NA
Tropical Japonica  504 41.70% 58.30% 0.00% 0.00% NA
Japonica Intermediate  241 53.50% 46.50% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221869113 C -> T LOC_Os12g35890.1 upstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:47.921; most accessible tissue: Minghui63 flower, score: 74.484 N N N N
vg1221869113 C -> T LOC_Os12g35895.1 upstream_gene_variant ; 3956.0bp to feature; MODIFIER silent_mutation Average:47.921; most accessible tissue: Minghui63 flower, score: 74.484 N N N N
vg1221869113 C -> T LOC_Os12g35880.1 downstream_gene_variant ; 4233.0bp to feature; MODIFIER silent_mutation Average:47.921; most accessible tissue: Minghui63 flower, score: 74.484 N N N N
vg1221869113 C -> T LOC_Os12g35880-LOC_Os12g35890 intergenic_region ; MODIFIER silent_mutation Average:47.921; most accessible tissue: Minghui63 flower, score: 74.484 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221869113 NA 2.51E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 1.59E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 3.07E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 4.89E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 2.16E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 1.20E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 5.19E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 1.17E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 3.31E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 1.97E-12 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 6.65E-11 mr1895_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113 NA 9.68E-10 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251