Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1221869113:

Variant ID: vg1221869113 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21869113
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

AACTTTTTCTTCAAACTTCTAACTTTTCCATTACATTAAAATTTTTCTACACACAAACTTCCAACTTTTTCATCACATCGTTCCAATTTCAATTAAACTT[C/T]
CAATTTTGGTGTGAACTAAACACGCCCGAAGAAGAAAATACGGAGGGGCTACGGGATCACCTATACATTTATCGACAAATTTTCTCCTAAAAATTTGACA

Reverse complement sequence

TGTCAAATTTTTAGGAGAAAATTTGTCGATAAATGTATAGGTGATCCCGTAGCCCCTCCGTATTTTCTTCTTCGGGCGTGTTTAGTTCACACCAAAATTG[G/A]
AAGTTTAATTGAAATTGGAACGATGTGATGAAAAAGTTGGAAGTTTGTGTGTAGAAAAATTTTAATGTAATGGAAAAGTTAGAAGTTTGAAGAAAAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.00%	41.00%	0.04%	0.00%	NA
All Indica	2759	72.60%	27.40%	0.07%	0.00%	NA
All Japonica	1512	30.50%	69.50%	0.00%	0.00%	NA
Aus	269	86.60%	13.40%	0.00%	0.00%	NA
Indica I	595	97.60%	2.20%	0.17%	0.00%	NA
Indica II	465	24.10%	75.90%	0.00%	0.00%	NA
Indica III	913	82.70%	17.30%	0.00%	0.00%	NA
Indica Intermediate	786	70.50%	29.40%	0.13%	0.00%	NA
Temperate Japonica	767	15.90%	84.10%	0.00%	0.00%	NA
Tropical Japonica	504	41.70%	58.30%	0.00%	0.00%	NA
Japonica Intermediate	241	53.50%	46.50%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	32.20%	67.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221869113	C -> T	LOC_Os12g35890.1	upstream_gene_variant ; 658.0bp to feature; MODIFIER	silent_mutation	Average:47.921; most accessible tissue: Minghui63 flower, score: 74.484	N	N	N	N
vg1221869113	C -> T	LOC_Os12g35895.1	upstream_gene_variant ; 3956.0bp to feature; MODIFIER	silent_mutation	Average:47.921; most accessible tissue: Minghui63 flower, score: 74.484	N	N	N	N
vg1221869113	C -> T	LOC_Os12g35880.1	downstream_gene_variant ; 4233.0bp to feature; MODIFIER	silent_mutation	Average:47.921; most accessible tissue: Minghui63 flower, score: 74.484	N	N	N	N
vg1221869113	C -> T	LOC_Os12g35880-LOC_Os12g35890	intergenic_region ; MODIFIER	silent_mutation	Average:47.921; most accessible tissue: Minghui63 flower, score: 74.484	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221869113	NA	2.51E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	1.59E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	3.07E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	4.89E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	2.16E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	1.20E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	5.19E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	1.17E-07	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	3.31E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	1.97E-12	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	6.65E-11	mr1895_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221869113	NA	9.68E-10	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251