Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221739812:

Variant ID: vg1221739812 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21739812
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGGAAGAGGAGCTTACGGAGGAGTAGATGTAGGAGCCCGAGGAGGAGTCGGTGCAGGATCCTGAGGAGGAGTCGGTGCTGGAGCCTGAGGTGGAGACA[A/G]
TGCTGGCGGAGCATGAGGAGGAGACGGTGCAGGATCCTGAGGAGGAGATGGCGGAGCCGGAGGAGATGGTGCACGAGACGCCGCTTGTCGCCCAGGGAGG

Reverse complement sequence

CCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCA[T/C]
TGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACATCTACTCCTCCGTAAGCTCCTCTTCCGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	14.30%	4.59%	25.12%	NA
All Indica	2759	61.20%	1.90%	6.60%	30.26%	NA
All Japonica	1512	54.20%	39.70%	1.32%	4.83%	NA
Aus	269	10.80%	1.10%	0.37%	87.73%	NA
Indica I	595	78.20%	1.80%	1.85%	18.15%	NA
Indica II	465	32.30%	2.60%	12.26%	52.90%	NA
Indica III	913	66.90%	0.50%	6.35%	26.18%	NA
Indica Intermediate	786	58.90%	3.20%	7.12%	30.79%	NA
Temperate Japonica	767	30.80%	64.10%	2.22%	2.87%	NA
Tropical Japonica	504	78.80%	12.70%	0.40%	8.13%	NA
Japonica Intermediate	241	77.20%	18.30%	0.41%	4.15%	NA
VI/Aromatic	96	62.50%	0.00%	10.42%	27.08%	NA
Intermediate	90	52.20%	24.40%	4.44%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221739812	A -> DEL	LOC_Os12g35720.1	N	frameshift_variant	Average:20.141; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1221739812	A -> G	LOC_Os12g35720.1	missense_variant ; p.Ile373Thr; MODERATE	nonsynonymous_codon ; I373T	Average:20.141; most accessible tissue: Zhenshan97 panicle, score: 32.308	unknown	unknown	TOLERATED	0.25

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221739812	NA	1.71E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	2.36E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	4.93E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	3.29E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	5.54E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	8.46E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	5.10E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	5.50E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	3.95E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	6.52E-10	mr1338_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	1.11E-07	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	1.86E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	5.91E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	8.13E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221739812	NA	2.72E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251