\
| Variant ID: vg1221719215 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21719215 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 113. )
TTCGTCGGATGAAGAAATAACAAAAATAAAAGTTTTAGATCTTGATGAGTTATTCAACTTTGTTGTTGATGACTTTTTCAATTGAAATCATTTAGTATTT[A/G]
AAAATGTTGTTTGAAGTTGTCATATTTTTAAATTCAAATTCAAGTTGTTCAATAAAATGTTATATTGAAAAATGACCAAACTAAAAGTTGTAAATCTTGA
TCAAGATTTACAACTTTTAGTTTGGTCATTTTTCAATATAACATTTTATTGAACAACTTGAATTTGAATTTAAAAATATGACAACTTCAAACAACATTTT[T/C]
AAATACTAAATGATTTCAATTGAAAAAGTCATCAACAACAAAGTTGAATAACTCATCAAGATCTAAAACTTTTATTTTTGTTATTTCTTCATCCGACGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 24.30% | 6.41% | 0.44% | NA |
| All Indica | 2759 | 85.20% | 3.60% | 10.47% | 0.72% | NA |
| All Japonica | 1512 | 38.80% | 60.80% | 0.40% | 0.00% | NA |
| Aus | 269 | 88.10% | 10.80% | 1.12% | 0.00% | NA |
| Indica I | 595 | 78.80% | 3.20% | 15.46% | 2.52% | NA |
| Indica II | 465 | 85.40% | 5.40% | 9.25% | 0.00% | NA |
| Indica III | 913 | 89.40% | 2.10% | 8.43% | 0.11% | NA |
| Indica Intermediate | 786 | 85.00% | 4.70% | 9.80% | 0.51% | NA |
| Temperate Japonica | 767 | 28.80% | 70.70% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 39.70% | 60.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 30.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 57.30% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 45.60% | 48.90% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221719215 | A -> DEL | N | N | silent_mutation | Average:17.897; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1221719215 | A -> G | LOC_Os12g35710-LOC_Os12g35720 | intergenic_region ; MODIFIER | silent_mutation | Average:17.897; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221719215 | NA | 1.14E-08 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 1.63E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 1.28E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 1.77E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 3.46E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 5.01E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 3.73E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | 3.83E-06 | 3.40E-14 | mr1575_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 4.65E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 6.58E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 5.50E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221719215 | NA | 2.83E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |