Variant ID: vg1221706812 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 21706812 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACACGTAGATGAGTCTTTAACTTGTTTATGAGAGATAATAACAGAGCTAGTGTGACTAAAATCACCTGCATGAAATTAATTAACAGTATTCCCTATACA[G/A]
TAGTATATGTTTAGGTTGCAAATCGACCCTTAAGTTGTATAGACGGTAATTCACTCATAAATCCACTTAAAATCACATGTACTATATAGCCTATAGTAAA
TTTACTATAGGCTATATAGTACATGTGATTTTAAGTGGATTTATGAGTGAATTACCGTCTATACAACTTAAGGGTCGATTTGCAACCTAAACATATACTA[C/T]
TGTATAGGGAATACTGTTAATTAATTTCATGCAGGTGATTTTAGTCACACTAGCTCTGTTATTATCTCTCATAAACAAGTTAAAGACTCATCTACGTGTG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.10% | 1.70% | 0.21% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 93.90% | 5.40% | 0.66% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 91.40% | 7.60% | 1.04% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 90.00% | 9.10% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1221706812 | G -> A | LOC_Os12g35700.1 | upstream_gene_variant ; 2960.0bp to feature; MODIFIER | silent_mutation | Average:28.056; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg1221706812 | G -> A | LOC_Os12g35710.1 | downstream_gene_variant ; 4428.0bp to feature; MODIFIER | silent_mutation | Average:28.056; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
vg1221706812 | G -> A | LOC_Os12g35700-LOC_Os12g35710 | intergenic_region ; MODIFIER | silent_mutation | Average:28.056; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1221706812 | NA | 9.78E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1221706812 | NA | 3.87E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1221706812 | NA | 4.74E-07 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1221706812 | NA | 8.86E-06 | mr1836 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1221706812 | 4.83E-07 | 4.83E-07 | mr1967 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |