\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221682087:

Variant ID: vg1221682087 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21682087
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGTACTTTCTGTTTCATCCATGCAGTGAGTGCAAGCCTTGTACCCCTTGTTGGACTGTCCGGATAGGTTGCTAAGTGCAGGCCAATCGTTGATAGTTA[C/T]
GAACAGCAGCGCTCGTAGGTTGAACTCCTCCTGTTTGTCCTCGTCCCACACGGGGACACCTTCCTTCTTCCACAACTGTTTAAGATCTTCGACCAGTGGT

Reverse complement sequence

ACCACTGGTCGAAGATCTTAAACAGTTGTGGAAGAAGGAAGGTGTCCCCGTGTGGGACGAGGACAAACAGGAGGAGTTCAACCTACGAGCGCTGCTGTTC[G/A]
TAACTATCAACGATTGGCCTGCACTTAGCAACCTATCCGGACAGTCCAACAAGGGGTACAAGGCTTGCACTCACTGCATGGATGAAACAGAAAGTACGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 1.50% 8.89% 16.67% NA
All Indica  2759 67.60% 0.00% 10.04% 22.40% NA
All Japonica  1512 90.90% 4.70% 0.73% 3.70% NA
Aus  269 24.50% 0.00% 37.17% 38.29% NA
Indica I  595 77.00% 0.00% 5.21% 17.82% NA
Indica II  465 77.00% 0.00% 7.74% 15.27% NA
Indica III  913 51.30% 0.00% 16.21% 32.53% NA
Indica Intermediate  786 73.80% 0.00% 7.89% 18.32% NA
Temperate Japonica  767 90.50% 6.30% 0.91% 2.35% NA
Tropical Japonica  504 92.70% 0.40% 0.40% 6.55% NA
Japonica Intermediate  241 88.40% 8.70% 0.83% 2.07% NA
VI/Aromatic  96 67.70% 0.00% 28.12% 4.17% NA
Intermediate  90 86.70% 0.00% 5.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221682087 C -> DEL LOC_Os12g35660.1 N frameshift_variant Average:39.713; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg1221682087 C -> T LOC_Os12g35660.1 missense_variant ; p.Val431Ile; MODERATE nonsynonymous_codon ; V431I Average:39.713; most accessible tissue: Minghui63 flag leaf, score: 55.781 unknown unknown TOLERATED 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221682087 NA 6.53E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 5.93E-06 4.08E-06 mr1222 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 2.35E-06 2.35E-06 mr1275 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 1.46E-06 1.46E-06 mr1284 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 8.94E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 5.16E-07 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 4.28E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 1.63E-08 1.63E-08 mr1370 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 8.18E-07 8.18E-07 mr1461 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 9.59E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 9.94E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 1.81E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 5.49E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 7.10E-06 1.66E-06 mr1882 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 1.67E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221682087 NA 1.66E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251