Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1221632752:

Variant ID: vg1221632752 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21632752
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTGACCTAGGCTAAAAAGGAAGGAAGGCTTTCGACCAACGCACGGGTATTTTTTCTAGTTTAGTAATACATAAGAAATCATATAAAAGAATCTATTTAA[C/A]
AAAACTCGCATGCTAAAGAGACGATCGAACTCCTAACTACAGCTCATGATTTTCTAAAAATATATATATATCCAAACGAACTCTCATAGTAAATTTCATT

Reverse complement sequence

AATGAAATTTACTATGAGAGTTCGTTTGGATATATATATATTTTTAGAAAATCATGAGCTGTAGTTAGGAGTTCGATCGTCTCTTTAGCATGCGAGTTTT[G/T]
TTAAATAGATTCTTTTATATGATTTCTTATGTATTACTAAACTAGAAAAAATACCCGTGCGTTGGTCGAAAGCCTTCCTTCCTTTTTAGCCTAGGTCAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	29.20%	0.02%	0.00%	NA
All Indica	2759	61.00%	39.00%	0.04%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	11.50%	88.50%	0.00%	0.00%	NA
Indica I	595	66.40%	33.60%	0.00%	0.00%	NA
Indica II	465	87.30%	12.70%	0.00%	0.00%	NA
Indica III	913	40.10%	59.80%	0.11%	0.00%	NA
Indica Intermediate	786	65.60%	34.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221632752	C -> A	LOC_Os12g35570.1	upstream_gene_variant ; 3045.0bp to feature; MODIFIER	silent_mutation	Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1221632752	C -> A	LOC_Os12g35580.1	upstream_gene_variant ; 4383.0bp to feature; MODIFIER	silent_mutation	Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1221632752	C -> A	LOC_Os12g35570.3	upstream_gene_variant ; 3045.0bp to feature; MODIFIER	silent_mutation	Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1221632752	C -> A	LOC_Os12g35570.2	upstream_gene_variant ; 3045.0bp to feature; MODIFIER	silent_mutation	Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1221632752	C -> A	LOC_Os12g35580.2	upstream_gene_variant ; 4383.0bp to feature; MODIFIER	silent_mutation	Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1221632752	C -> A	LOC_Os12g35570-LOC_Os12g35580	intergenic_region ; MODIFIER	silent_mutation	Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221632752	NA	5.83E-07	mr1134	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632752	NA	6.61E-07	mr1135	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632752	NA	6.50E-06	mr1504	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632752	5.62E-08	2.91E-10	mr1672	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632752	NA	5.69E-06	mr1672_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251