\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221632752:

Variant ID: vg1221632752 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21632752
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGACCTAGGCTAAAAAGGAAGGAAGGCTTTCGACCAACGCACGGGTATTTTTTCTAGTTTAGTAATACATAAGAAATCATATAAAAGAATCTATTTAA[C/A]
AAAACTCGCATGCTAAAGAGACGATCGAACTCCTAACTACAGCTCATGATTTTCTAAAAATATATATATATCCAAACGAACTCTCATAGTAAATTTCATT

Reverse complement sequence

AATGAAATTTACTATGAGAGTTCGTTTGGATATATATATATTTTTAGAAAATCATGAGCTGTAGTTAGGAGTTCGATCGTCTCTTTAGCATGCGAGTTTT[G/T]
TTAAATAGATTCTTTTATATGATTTCTTATGTATTACTAAACTAGAAAAAATACCCGTGCGTTGGTCGAAAGCCTTCCTTCCTTTTTAGCCTAGGTCAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 29.20% 0.02% 0.00% NA
All Indica  2759 61.00% 39.00% 0.04% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 11.50% 88.50% 0.00% 0.00% NA
Indica I  595 66.40% 33.60% 0.00% 0.00% NA
Indica II  465 87.30% 12.70% 0.00% 0.00% NA
Indica III  913 40.10% 59.80% 0.11% 0.00% NA
Indica Intermediate  786 65.60% 34.40% 0.00% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221632752 C -> A LOC_Os12g35570.1 upstream_gene_variant ; 3045.0bp to feature; MODIFIER silent_mutation Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632752 C -> A LOC_Os12g35580.1 upstream_gene_variant ; 4383.0bp to feature; MODIFIER silent_mutation Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632752 C -> A LOC_Os12g35570.3 upstream_gene_variant ; 3045.0bp to feature; MODIFIER silent_mutation Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632752 C -> A LOC_Os12g35570.2 upstream_gene_variant ; 3045.0bp to feature; MODIFIER silent_mutation Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632752 C -> A LOC_Os12g35580.2 upstream_gene_variant ; 4383.0bp to feature; MODIFIER silent_mutation Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1221632752 C -> A LOC_Os12g35570-LOC_Os12g35580 intergenic_region ; MODIFIER silent_mutation Average:57.56; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221632752 NA 5.83E-07 mr1134 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632752 NA 6.61E-07 mr1135 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632752 NA 6.50E-06 mr1504 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632752 5.62E-08 2.91E-10 mr1672 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221632752 NA 5.69E-06 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251