\
| Variant ID: vg1221504838 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21504838 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
GCACCGCTAGCGGCGCCTATTTGTTAGTTATTTCAAATTTTCTTTTCAGAACTAGTTATTTCAATTTGAGTACAATGTAGTATCACTACAAATATATGCT[C/T]
CCTCCGTCTCATATTTCTACTATTATAAAAGTTGAAAATGTTTTTACCAGAATTTTGGTACATCATCTGTGTTGGATTAGGTTTTGAGTTGGGTCTTTAA
TTAAAGACCCAACTCAAAACCTAATCCAACACAGATGATGTACCAAAATTCTGGTAAAAACATTTTCAACTTTTATAATAGTAGAAATATGAGACGGAGG[G/A]
AGCATATATTTGTAGTGATACTACATTGTACTCAAATTGAAATAACTAGTTCTGAAAAGAAAATTTGAAATAACTAACAAATAGGCGCCGCTAGCGGTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 2.30% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 3.90% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.60% | 7.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221504838 | C -> T | LOC_Os12g35360.1 | upstream_gene_variant ; 3994.0bp to feature; MODIFIER | silent_mutation | Average:49.972; most accessible tissue: Zhenshan97 flower, score: 64.273 | N | N | N | N |
| vg1221504838 | C -> T | LOC_Os12g35364.1 | upstream_gene_variant ; 614.0bp to feature; MODIFIER | silent_mutation | Average:49.972; most accessible tissue: Zhenshan97 flower, score: 64.273 | N | N | N | N |
| vg1221504838 | C -> T | LOC_Os12g35370.1 | upstream_gene_variant ; 757.0bp to feature; MODIFIER | silent_mutation | Average:49.972; most accessible tissue: Zhenshan97 flower, score: 64.273 | N | N | N | N |
| vg1221504838 | C -> T | LOC_Os12g35364-LOC_Os12g35370 | intergenic_region ; MODIFIER | silent_mutation | Average:49.972; most accessible tissue: Zhenshan97 flower, score: 64.273 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221504838 | 4.16E-09 | 6.08E-16 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 3.10E-08 | 1.27E-15 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 5.81E-08 | NA | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 6.71E-08 | NA | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 3.18E-09 | 2.88E-18 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 8.84E-08 | 5.71E-16 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | NA | 5.35E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 6.03E-11 | 4.21E-18 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 6.98E-10 | 1.77E-16 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 2.20E-09 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 8.11E-10 | NA | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 7.44E-11 | 8.09E-17 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | 6.76E-10 | 5.62E-16 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | NA | 2.45E-06 | mr1887_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221504838 | NA | 1.43E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |