\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221504838:

Variant ID: vg1221504838 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21504838
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GCACCGCTAGCGGCGCCTATTTGTTAGTTATTTCAAATTTTCTTTTCAGAACTAGTTATTTCAATTTGAGTACAATGTAGTATCACTACAAATATATGCT[C/T]
CCTCCGTCTCATATTTCTACTATTATAAAAGTTGAAAATGTTTTTACCAGAATTTTGGTACATCATCTGTGTTGGATTAGGTTTTGAGTTGGGTCTTTAA

Reverse complement sequence

TTAAAGACCCAACTCAAAACCTAATCCAACACAGATGATGTACCAAAATTCTGGTAAAAACATTTTCAACTTTTATAATAGTAGAAATATGAGACGGAGG[G/A]
AGCATATATTTGTAGTGATACTACATTGTACTCAAATTGAAATAACTAGTTCTGAAAAGAAAATTTGAAATAACTAACAAATAGGCGCCGCTAGCGGTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 2.30% 0.17% 0.00% NA
All Indica  2759 95.80% 3.90% 0.25% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.60% 7.90% 0.50% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.50% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221504838 C -> T LOC_Os12g35360.1 upstream_gene_variant ; 3994.0bp to feature; MODIFIER silent_mutation Average:49.972; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1221504838 C -> T LOC_Os12g35364.1 upstream_gene_variant ; 614.0bp to feature; MODIFIER silent_mutation Average:49.972; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1221504838 C -> T LOC_Os12g35370.1 upstream_gene_variant ; 757.0bp to feature; MODIFIER silent_mutation Average:49.972; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1221504838 C -> T LOC_Os12g35364-LOC_Os12g35370 intergenic_region ; MODIFIER silent_mutation Average:49.972; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221504838 4.16E-09 6.08E-16 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 3.10E-08 1.27E-15 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 5.81E-08 NA mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 6.71E-08 NA mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 3.18E-09 2.88E-18 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 8.84E-08 5.71E-16 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 NA 5.35E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 6.03E-11 4.21E-18 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 6.98E-10 1.77E-16 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 2.20E-09 NA mr1141_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 8.11E-10 NA mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 7.44E-11 8.09E-17 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 6.76E-10 5.62E-16 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 NA 2.45E-06 mr1887_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221504838 NA 1.43E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251