\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221482388:

Variant ID: vg1221482388 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21482388
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CATATATTCTTGAGAGATTGAAGGAAGAAGTCCCACTCATACAAACTCCGTTTGAATTAGCCCAGTGTGAGTTGGTAGGGTGCATGGCCTGGCCCAACTG[A/C]
AGAATAACTTGCTTGGCAATCTGATTGGATTGTAGGGATCATATATATTACTAGTATGATTTCTCCAACAACTTTCTACATTAGCATTATTAAATAACTA

Reverse complement sequence

TAGTTATTTAATAATGCTAATGTAGAAAGTTGTTGGAGAAATCATACTAGTAATATATATGATCCCTACAATCCAATCAGATTGCCAAGCAAGTTATTCT[T/G]
CAGTTGGGCCAGGCCATGCACCCTACCAACTCACACTGGGCTAATTCAAACGGAGTTTGTATGAGTGGGACTTCTTCCTTCAATCTCTCAAGAATATATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 4.80% 0.68% 0.00% NA
All Indica  2759 99.20% 0.70% 0.07% 0.00% NA
All Japonica  1512 85.60% 12.50% 1.92% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.80% 0.25% 0.00% NA
Temperate Japonica  767 88.30% 8.60% 3.13% 0.00% NA
Tropical Japonica  504 80.80% 18.50% 0.79% 0.00% NA
Japonica Intermediate  241 87.10% 12.40% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221482388 A -> C LOC_Os12g35340.1 downstream_gene_variant ; 1313.0bp to feature; MODIFIER silent_mutation Average:80.841; most accessible tissue: Minghui63 root, score: 93.274 N N N N
vg1221482388 A -> C LOC_Os12g35340-LOC_Os12g35350 intergenic_region ; MODIFIER silent_mutation Average:80.841; most accessible tissue: Minghui63 root, score: 93.274 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1221482388 A C -0.01 -0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221482388 1.11E-08 NA Grain_weight All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1221482388 7.38E-06 NA mr1037_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221482388 NA 2.68E-06 mr1037_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221482388 NA 1.79E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251