\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221236365:

Variant ID: vg1221236365 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21236365
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTGTAAACTTAAAAAATACATGCTACAAGTCCAAAAAAAATAGCAAGGGAAAATCCCTACATCCATTAATAGAAAATGAATGGTTGCTCTTTTCATGC[C/T]
GTCGGGAATGGAAGAGGCTCACGTCCCTCTGACTTTACGTCAGAGGAGCTCCGTCTGCCGGGAATAGCCCTTTGTACCCCATTCTTTTCCTTTGTTTCTC

Reverse complement sequence

GAGAAACAAAGGAAAAGAATGGGGTACAAAGGGCTATTCCCGGCAGACGGAGCTCCTCTGACGTAAAGTCAGAGGGACGTGAGCCTCTTCCATTCCCGAC[G/A]
GCATGAAAAGAGCAACCATTCATTTTCTATTAATGGATGTAGGGATTTTCCCTTGCTATTTTTTTTGGACTTGTAGCATGTATTTTTTAAGTTTACAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.80% 0.11% 0.00% NA
All Indica  2759 65.50% 34.40% 0.14% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 14.10% 85.90% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 32.30% 67.50% 0.22% 0.00% NA
Indica III  913 57.50% 42.20% 0.33% 0.00% NA
Indica Intermediate  786 70.20% 29.80% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221236365 C -> T LOC_Os12g34874.2 upstream_gene_variant ; 1242.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1221236365 C -> T LOC_Os12g34874.1 upstream_gene_variant ; 1242.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1221236365 C -> T LOC_Os12g34874.3 upstream_gene_variant ; 1242.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1221236365 C -> T LOC_Os12g34880.1 downstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1221236365 C -> T LOC_Os12g34890.1 downstream_gene_variant ; 4022.0bp to feature; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1221236365 C -> T LOC_Os12g34874-LOC_Os12g34880 intergenic_region ; MODIFIER silent_mutation Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221236365 NA 4.31E-11 mr1193 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 3.13E-07 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 4.00E-12 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 5.85E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 1.12E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 5.15E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 1.35E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 6.39E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 2.61E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 6.11E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 3.46E-06 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 1.35E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 4.00E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 1.62E-12 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 3.04E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365 NA 4.28E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251