Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221236365:

Variant ID: vg1221236365 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21236365
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTGTAAACTTAAAAAATACATGCTACAAGTCCAAAAAAAATAGCAAGGGAAAATCCCTACATCCATTAATAGAAAATGAATGGTTGCTCTTTTCATGC[C/T]
GTCGGGAATGGAAGAGGCTCACGTCCCTCTGACTTTACGTCAGAGGAGCTCCGTCTGCCGGGAATAGCCCTTTGTACCCCATTCTTTTCCTTTGTTTCTC

Reverse complement sequence

GAGAAACAAAGGAAAAGAATGGGGTACAAAGGGCTATTCCCGGCAGACGGAGCTCCTCTGACGTAAAGTCAGAGGGACGTGAGCCTCTTCCATTCCCGAC[G/A]
GCATGAAAAGAGCAACCATTCATTTTCTATTAATGGATGTAGGGATTTTCCCTTGCTATTTTTTTTGGACTTGTAGCATGTATTTTTTAAGTTTACAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	26.80%	0.11%	0.00%	NA
All Indica	2759	65.50%	34.40%	0.14%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	14.10%	85.90%	0.00%	0.00%	NA
Indica I	595	97.30%	2.70%	0.00%	0.00%	NA
Indica II	465	32.30%	67.50%	0.22%	0.00%	NA
Indica III	913	57.50%	42.20%	0.33%	0.00%	NA
Indica Intermediate	786	70.20%	29.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	42.70%	57.30%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221236365	C -> T	LOC_Os12g34874.2	upstream_gene_variant ; 1242.0bp to feature; MODIFIER	silent_mutation	Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1221236365	C -> T	LOC_Os12g34874.1	upstream_gene_variant ; 1242.0bp to feature; MODIFIER	silent_mutation	Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1221236365	C -> T	LOC_Os12g34874.3	upstream_gene_variant ; 1242.0bp to feature; MODIFIER	silent_mutation	Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1221236365	C -> T	LOC_Os12g34880.1	downstream_gene_variant ; 1867.0bp to feature; MODIFIER	silent_mutation	Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1221236365	C -> T	LOC_Os12g34890.1	downstream_gene_variant ; 4022.0bp to feature; MODIFIER	silent_mutation	Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1221236365	C -> T	LOC_Os12g34874-LOC_Os12g34880	intergenic_region ; MODIFIER	silent_mutation	Average:48.044; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221236365	NA	4.31E-11	mr1193	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	3.13E-07	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	4.00E-12	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	5.85E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	1.12E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	5.15E-08	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	1.35E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	6.39E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	2.61E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	6.11E-08	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	3.46E-06	mr1919	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	1.35E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	4.00E-06	mr1169_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	1.62E-12	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	3.04E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221236365	NA	4.28E-19	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251