\
| Variant ID: vg1221154570 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21154570 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.37, others allele: 0.00, population size: 90. )
TCATCTCAATCGGACAGTAAACCCATCTCAATTGGGCACAGAGTCCGTCACAGGCTAGAAGTCACAGATGTGAAGAGTTATCTCAATCGGGCAAACGGCC[A/G]
TCACGGATGAATCTATCTCAATCGGGCCCTAATTAAAGCCCGTCACCGATAGCTTTGACCCAGACGACCAGTCAAACTATAGCCCGTCACGGATGACCTA
TAGGTCATCCGTGACGGGCTATAGTTTGACTGGTCGTCTGGGTCAAAGCTATCGGTGACGGGCTTTAATTAGGGCCCGATTGAGATAGATTCATCCGTGA[T/C]
GGCCGTTTGCCCGATTGAGATAACTCTTCACATCTGTGACTTCTAGCCTGTGACGGACTCTGTGCCCAATTGAGATGGGTTTACTGTCCGATTGAGATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 13.80% | 0.36% | 18.28% | NA |
| All Indica | 2759 | 55.10% | 13.40% | 0.62% | 30.88% | NA |
| All Japonica | 1512 | 98.30% | 1.50% | 0.00% | 0.20% | NA |
| Aus | 269 | 16.40% | 82.90% | 0.00% | 0.74% | NA |
| Indica I | 595 | 80.20% | 15.80% | 0.00% | 4.03% | NA |
| Indica II | 465 | 24.70% | 8.20% | 1.51% | 65.59% | NA |
| Indica III | 913 | 52.10% | 11.80% | 0.55% | 35.49% | NA |
| Indica Intermediate | 786 | 57.60% | 16.40% | 0.64% | 25.32% | NA |
| Temperate Japonica | 767 | 99.30% | 0.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 97.00% | 2.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 78.10% | 20.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 76.70% | 16.70% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221154570 | A -> DEL | N | N | silent_mutation | Average:41.492; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg1221154570 | A -> G | LOC_Os12g34802-LOC_Os12g34810 | intergenic_region ; MODIFIER | silent_mutation | Average:41.492; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221154570 | NA | 2.43E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 2.34E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 3.00E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 4.96E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.41E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.12E-08 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 2.15E-07 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 2.74E-08 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 2.15E-06 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 9.87E-06 | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.09E-06 | mr1294 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 9.64E-07 | mr1297 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 7.32E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 2.72E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 6.87E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 8.31E-06 | mr1358 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 6.26E-06 | mr1371 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 2.36E-06 | mr1372 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.41E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 3.97E-07 | mr1374 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 4.03E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 7.33E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.19E-06 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 5.38E-07 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.07E-07 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 9.82E-06 | mr1419 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 3.57E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 8.90E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 8.21E-06 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 5.69E-06 | mr1434 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 5.65E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 3.63E-06 | mr1444 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 4.77E-06 | mr1472 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 8.93E-07 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.21E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 6.56E-08 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 9.33E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 4.28E-07 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 5.08E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 2.43E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 3.07E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 9.69E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.16E-08 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.05E-07 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 4.80E-06 | mr1724 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 6.28E-06 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.32E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | 3.21E-06 | 4.49E-10 | mr1774 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 8.49E-07 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 8.39E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.08E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 2.48E-06 | mr1888 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 1.19E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 3.16E-10 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 5.08E-06 | mr1976 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221154570 | NA | 8.90E-07 | mr1985 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |