Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1221092868:

Variant ID: vg1221092868 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21092868
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCCTTAATATTATCCAAAGCCTTTTGCTTCTCTGCCCCCCAAGTAAACTGCTGATCGGCTTTTAACCTCAATAAGGGTGTAAAAGGTTCCAACCTTC[C/T]
GGACAAATTAGAAATAAACCTTCTAACAAAATTTATCTTGCCGATCATTTCTTGTAGCTCTGTCTTATTTTCTGGGGGCTGAATCTTCTTGATCGCATTA

Reverse complement sequence

TAATGCGATCAAGAAGATTCAGCCCCCAGAAAATAAGACAGAGCTACAAGAAATGATCGGCAAGATAAATTTTGTTAGAAGGTTTATTTCTAATTTGTCC[G/A]
GAAGGTTGGAACCTTTTACACCCTTATTGAGGTTAAAAGCCGATCAGCAGTTTACTTGGGGGGCAGAGAAGCAAAAGGCTTTGGATAATATTAAGGAGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 33.10% 5.16% 21.58% NA
All Indica  2759 47.30% 16.40% 7.43% 28.81% NA
All Japonica  1512 31.50% 66.70% 0.66% 1.12% NA
Aus  269 2.20% 18.60% 8.55% 70.63% NA
Indica I  595 78.50% 5.40% 11.09% 5.04% NA
Indica II  465 35.70% 27.30% 5.59% 31.40% NA
Indica III  913 35.60% 18.40% 5.04% 40.96% NA
Indica Intermediate  786 44.30% 16.00% 8.52% 31.17% NA
Temperate Japonica  767 5.50% 93.50% 0.26% 0.78% NA
Tropical Japonica  504 74.40% 22.80% 1.19% 1.59% NA
Japonica Intermediate  241 24.90% 73.00% 0.83% 1.24% NA
VI/Aromatic  96 70.80% 18.80% 5.21% 5.21% NA
Intermediate  90 43.30% 41.10% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221092868 C -> DEL LOC_Os12g34740.1 N frameshift_variant Average:15.707; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg1221092868 C -> T LOC_Os12g34740.1 missense_variant ; p.Gly1007Arg; MODERATE nonsynonymous_codon ; G1007R Average:15.707; most accessible tissue: Minghui63 young leaf, score: 21.268 unknown unknown TOLERATED 0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221092868 NA 6.12E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 2.10E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 3.43E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 8.53E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 4.33E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 6.10E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 6.00E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 3.81E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 4.17E-07 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 2.72E-07 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.50E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 7.13E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 7.91E-06 7.91E-06 mr1234 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.25E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 3.32E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 5.66E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 6.09E-08 2.30E-22 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 7.99E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 5.94E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.06E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 9.38E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.76E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.22E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 5.09E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 9.37E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.09E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 6.46E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 9.89E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 6.52E-09 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 3.92E-07 5.57E-27 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.65E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 2.80E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.33E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221092868 NA 1.53E-12 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251