Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221060594:

Variant ID: vg1221060594 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21060594
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAAGCTCGTAGGAAATTATATAGGCTGATAAGACGGGGAACAATACTTCATATGCATATATATATATATATATATATATATATATATAGCCAGATCG[G/A]
TTATGCAGATCAGGAAACTCCGGAAATGCGACAGGACACATTGCACGTAGGCATAGGAGGCATCAGGAGTTGTCCTTCTTTCGATCCTTCATCGCCAAGG

Reverse complement sequence

CCTTGGCGATGAAGGATCGAAAGAAGGACAACTCCTGATGCCTCCTATGCCTACGTGCAATGTGTCCTGTCGCATTTCCGGAGTTTCCTGATCTGCATAA[C/T]
CGATCTGGCTATATATATATATATATATATATATATATATATGCATATGAAGTATTGTTCCCCGTCTTATCAGCCTATATAATTTCCTACGAGCTTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.10%	28.30%	0.11%	29.41%	NA
All Indica	2759	49.90%	8.40%	0.11%	41.57%	NA
All Japonica	1512	32.10%	66.20%	0.00%	1.65%	NA
Aus	269	3.00%	26.00%	0.00%	71.00%	NA
Indica I	595	79.50%	11.80%	0.00%	8.74%	NA
Indica II	465	44.90%	11.60%	0.22%	43.23%	NA
Indica III	913	36.30%	1.60%	0.00%	62.10%	NA
Indica Intermediate	786	46.40%	11.70%	0.25%	41.60%	NA
Temperate Japonica	767	6.00%	93.40%	0.00%	0.65%	NA
Tropical Japonica	504	75.80%	21.00%	0.00%	3.17%	NA
Japonica Intermediate	241	24.10%	74.30%	0.00%	1.66%	NA
VI/Aromatic	96	83.30%	4.20%	0.00%	12.50%	NA
Intermediate	90	44.40%	36.70%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221060594	G -> DEL	N	N	silent_mutation	Average:59.918; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1221060594	G -> A	LOC_Os12g34700.1	upstream_gene_variant ; 4156.0bp to feature; MODIFIER	silent_mutation	Average:59.918; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1221060594	G -> A	LOC_Os12g34690.1	downstream_gene_variant ; 63.0bp to feature; MODIFIER	silent_mutation	Average:59.918; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1221060594	G -> A	LOC_Os12g34680-LOC_Os12g34690	intergenic_region ; MODIFIER	silent_mutation	Average:59.918; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221060594	NA	7.36E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	1.90E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	7.94E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	2.17E-11	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	7.15E-07	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	5.54E-07	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	4.78E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	7.05E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	4.52E-11	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	7.36E-06	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	7.55E-10	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	4.65E-07	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	2.48E-07	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	8.95E-08	1.11E-22	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	7.25E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	4.02E-08	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	1.32E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	1.94E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	1.11E-09	mr1599	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	3.23E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	3.00E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	2.71E-09	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	1.02E-06	9.36E-28	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	8.35E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594	NA	3.91E-12	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251