\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221060594:

Variant ID: vg1221060594 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21060594
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAAGCTCGTAGGAAATTATATAGGCTGATAAGACGGGGAACAATACTTCATATGCATATATATATATATATATATATATATATATATAGCCAGATCG[G/A]
TTATGCAGATCAGGAAACTCCGGAAATGCGACAGGACACATTGCACGTAGGCATAGGAGGCATCAGGAGTTGTCCTTCTTTCGATCCTTCATCGCCAAGG

Reverse complement sequence

CCTTGGCGATGAAGGATCGAAAGAAGGACAACTCCTGATGCCTCCTATGCCTACGTGCAATGTGTCCTGTCGCATTTCCGGAGTTTCCTGATCTGCATAA[C/T]
CGATCTGGCTATATATATATATATATATATATATATATATATGCATATGAAGTATTGTTCCCCGTCTTATCAGCCTATATAATTTCCTACGAGCTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 28.30% 0.11% 29.41% NA
All Indica  2759 49.90% 8.40% 0.11% 41.57% NA
All Japonica  1512 32.10% 66.20% 0.00% 1.65% NA
Aus  269 3.00% 26.00% 0.00% 71.00% NA
Indica I  595 79.50% 11.80% 0.00% 8.74% NA
Indica II  465 44.90% 11.60% 0.22% 43.23% NA
Indica III  913 36.30% 1.60% 0.00% 62.10% NA
Indica Intermediate  786 46.40% 11.70% 0.25% 41.60% NA
Temperate Japonica  767 6.00% 93.40% 0.00% 0.65% NA
Tropical Japonica  504 75.80% 21.00% 0.00% 3.17% NA
Japonica Intermediate  241 24.10% 74.30% 0.00% 1.66% NA
VI/Aromatic  96 83.30% 4.20% 0.00% 12.50% NA
Intermediate  90 44.40% 36.70% 2.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221060594 G -> DEL N N silent_mutation Average:59.918; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1221060594 G -> A LOC_Os12g34700.1 upstream_gene_variant ; 4156.0bp to feature; MODIFIER silent_mutation Average:59.918; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1221060594 G -> A LOC_Os12g34690.1 downstream_gene_variant ; 63.0bp to feature; MODIFIER silent_mutation Average:59.918; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1221060594 G -> A LOC_Os12g34680-LOC_Os12g34690 intergenic_region ; MODIFIER silent_mutation Average:59.918; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221060594 NA 7.36E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 1.90E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 7.94E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 2.17E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 7.15E-07 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 5.54E-07 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 4.78E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 7.05E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 4.52E-11 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 7.36E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 7.55E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 4.65E-07 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 2.48E-07 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 8.95E-08 1.11E-22 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 7.25E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 4.02E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 1.32E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 1.94E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 1.11E-09 mr1599 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 3.23E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 3.00E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 2.71E-09 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 1.02E-06 9.36E-28 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 8.35E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221060594 NA 3.91E-12 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251