\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221037385:

Variant ID: vg1221037385 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21037385
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATGAACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACATGTACCAACTAAATCCGAGCTAAGATGAATTAGTTA[T/C]
GAATTTTTAAAGATTAAATCGGATTAAATCATTTATATAGATTTTAATTGAATTATGACGCAATAAAGAATTAATTTTGAAAAGGAAAAATGATTTATTG

Reverse complement sequence

CAATAAATCATTTTTCCTTTTCAAAATTAATTCTTTATTGCGTCATAATTCAATTAAAATCTATATAAATGATTTAATCCGATTTAATCTTTAAAAATTC[A/G]
TAACTAATTCATCTTAGCTCGGATTTAGTTGGTACATGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTTCATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 6.40% 5.25% 5.73% NA
All Indica  2759 85.40% 0.20% 6.38% 7.97% NA
All Japonica  1512 80.60% 16.90% 2.18% 0.40% NA
Aus  269 60.60% 11.50% 12.64% 15.24% NA
Indica I  595 96.30% 0.20% 1.51% 2.02% NA
Indica II  465 78.70% 0.00% 8.82% 12.47% NA
Indica III  913 82.90% 0.20% 7.45% 9.42% NA
Indica Intermediate  786 84.10% 0.40% 7.38% 8.14% NA
Temperate Japonica  767 82.30% 15.10% 2.22% 0.39% NA
Tropical Japonica  504 82.70% 14.90% 1.98% 0.40% NA
Japonica Intermediate  241 70.50% 26.60% 2.49% 0.41% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 84.40% 7.80% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221037385 T -> C LOC_Os12g34650.1 upstream_gene_variant ; 813.0bp to feature; MODIFIER silent_mutation Average:35.54; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1221037385 T -> C LOC_Os12g34650-LOC_Os12g34670 intergenic_region ; MODIFIER silent_mutation Average:35.54; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1221037385 T -> DEL N N silent_mutation Average:35.54; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221037385 6.91E-07 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221037385 2.63E-09 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221037385 3.43E-07 NA mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221037385 NA 7.92E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221037385 NA 1.46E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251