\
| Variant ID: vg1221037385 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21037385 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCATGAACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACATGTACCAACTAAATCCGAGCTAAGATGAATTAGTTA[T/C]
GAATTTTTAAAGATTAAATCGGATTAAATCATTTATATAGATTTTAATTGAATTATGACGCAATAAAGAATTAATTTTGAAAAGGAAAAATGATTTATTG
CAATAAATCATTTTTCCTTTTCAAAATTAATTCTTTATTGCGTCATAATTCAATTAAAATCTATATAAATGATTTAATCCGATTTAATCTTTAAAAATTC[A/G]
TAACTAATTCATCTTAGCTCGGATTTAGTTGGTACATGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTTCATGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 6.40% | 5.25% | 5.73% | NA |
| All Indica | 2759 | 85.40% | 0.20% | 6.38% | 7.97% | NA |
| All Japonica | 1512 | 80.60% | 16.90% | 2.18% | 0.40% | NA |
| Aus | 269 | 60.60% | 11.50% | 12.64% | 15.24% | NA |
| Indica I | 595 | 96.30% | 0.20% | 1.51% | 2.02% | NA |
| Indica II | 465 | 78.70% | 0.00% | 8.82% | 12.47% | NA |
| Indica III | 913 | 82.90% | 0.20% | 7.45% | 9.42% | NA |
| Indica Intermediate | 786 | 84.10% | 0.40% | 7.38% | 8.14% | NA |
| Temperate Japonica | 767 | 82.30% | 15.10% | 2.22% | 0.39% | NA |
| Tropical Japonica | 504 | 82.70% | 14.90% | 1.98% | 0.40% | NA |
| Japonica Intermediate | 241 | 70.50% | 26.60% | 2.49% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 84.40% | 7.80% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221037385 | T -> C | LOC_Os12g34650.1 | upstream_gene_variant ; 813.0bp to feature; MODIFIER | silent_mutation | Average:35.54; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1221037385 | T -> C | LOC_Os12g34650-LOC_Os12g34670 | intergenic_region ; MODIFIER | silent_mutation | Average:35.54; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1221037385 | T -> DEL | N | N | silent_mutation | Average:35.54; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221037385 | 6.91E-07 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221037385 | 2.63E-09 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221037385 | 3.43E-07 | NA | mr1679_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221037385 | NA | 7.92E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221037385 | NA | 1.46E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |