Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221014609:

Variant ID: vg1221014609 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21014609
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGGAGCAAGACATTCTAAAGGCAGAGATACAGATAGAGAGATGAAGAACACTATACATCTACATGGACAGAGGCATATCAAGCCACTGATCCATTCAT[G/T]
AATCGGCGGTTGCTTAATTTCTGTATTGCCTAGCTGTTTGGCTTAGGAGGTATCAGGAGTTGTTATTACATCAATCAGTCTTCGTGATGACCGGCTAGGT

Reverse complement sequence

ACCTAGCCGGTCATCACGAAGACTGATTGATGTAATAACAACTCCTGATACCTCCTAAGCCAAACAGCTAGGCAATACAGAAATTAAGCAACCGCCGATT[C/A]
ATGAATGGATCAGTGGCTTGATATGCCTCTGTCCATGTAGATGTATAGTGTTCTTCATCTCTCTATCTGTATCTCTGCCTTTAGAATGTCTTGCTCCACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	2.50%	1.42%	27.21%	NA
All Indica	2759	55.10%	4.20%	2.25%	38.38%	NA
All Japonica	1512	98.30%	0.00%	0.07%	1.59%	NA
Aus	269	33.50%	0.00%	1.12%	65.43%	NA
Indica I	595	81.20%	7.90%	4.37%	6.55%	NA
Indica II	465	58.50%	2.20%	1.51%	37.85%	NA
Indica III	913	38.90%	0.10%	1.20%	59.80%	NA
Indica Intermediate	786	52.30%	7.50%	2.29%	37.91%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	96.80%	0.00%	0.20%	2.98%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	87.50%	0.00%	0.00%	12.50%	NA
Intermediate	90	81.10%	1.10%	1.11%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221014609	G -> DEL	N	N	silent_mutation	Average:44.451; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N
vg1221014609	G -> T	LOC_Os12g34630-LOC_Os12g34640	intergenic_region ; MODIFIER	silent_mutation	Average:44.451; most accessible tissue: Zhenshan97 young leaf, score: 82.539	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221014609	4.78E-08	1.21E-14	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	5.26E-07	5.38E-14	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	5.71E-09	NA	mr1141	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	8.30E-09	1.11E-08	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	1.16E-09	1.68E-18	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	7.56E-08	7.95E-16	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	NA	2.04E-06	mr1460	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	2.67E-06	2.67E-06	mr1460	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	NA	5.77E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	4.26E-07	4.01E-15	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	2.19E-06	1.46E-13	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	3.41E-06	NA	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	1.94E-06	NA	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	4.10E-06	6.71E-13	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609	NA	4.07E-12	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251