\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221014609:

Variant ID: vg1221014609 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 21014609
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGGAGCAAGACATTCTAAAGGCAGAGATACAGATAGAGAGATGAAGAACACTATACATCTACATGGACAGAGGCATATCAAGCCACTGATCCATTCAT[G/T]
AATCGGCGGTTGCTTAATTTCTGTATTGCCTAGCTGTTTGGCTTAGGAGGTATCAGGAGTTGTTATTACATCAATCAGTCTTCGTGATGACCGGCTAGGT

Reverse complement sequence

ACCTAGCCGGTCATCACGAAGACTGATTGATGTAATAACAACTCCTGATACCTCCTAAGCCAAACAGCTAGGCAATACAGAAATTAAGCAACCGCCGATT[C/A]
ATGAATGGATCAGTGGCTTGATATGCCTCTGTCCATGTAGATGTATAGTGTTCTTCATCTCTCTATCTGTATCTCTGCCTTTAGAATGTCTTGCTCCACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 2.50% 1.42% 27.21% NA
All Indica  2759 55.10% 4.20% 2.25% 38.38% NA
All Japonica  1512 98.30% 0.00% 0.07% 1.59% NA
Aus  269 33.50% 0.00% 1.12% 65.43% NA
Indica I  595 81.20% 7.90% 4.37% 6.55% NA
Indica II  465 58.50% 2.20% 1.51% 37.85% NA
Indica III  913 38.90% 0.10% 1.20% 59.80% NA
Indica Intermediate  786 52.30% 7.50% 2.29% 37.91% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 96.80% 0.00% 0.20% 2.98% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 87.50% 0.00% 0.00% 12.50% NA
Intermediate  90 81.10% 1.10% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1221014609 G -> DEL N N silent_mutation Average:44.451; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg1221014609 G -> T LOC_Os12g34630-LOC_Os12g34640 intergenic_region ; MODIFIER silent_mutation Average:44.451; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1221014609 4.78E-08 1.21E-14 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 5.26E-07 5.38E-14 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 5.71E-09 NA mr1141 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 8.30E-09 1.11E-08 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 1.16E-09 1.68E-18 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 7.56E-08 7.95E-16 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 NA 2.04E-06 mr1460 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 2.67E-06 2.67E-06 mr1460 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 NA 5.77E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 4.26E-07 4.01E-15 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 2.19E-06 1.46E-13 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 3.41E-06 NA mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 1.94E-06 NA mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 4.10E-06 6.71E-13 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221014609 NA 4.07E-12 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251