\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220914154:

Variant ID: vg1220914154 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20914154
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGCAAATCCACCCCTACTCAGGACGAAGATGCAACTTCGCCACGATTCGGGTGTCGGGTTTTTGGAGACTCTATCTCGCCGTGCGCTTTGTCTTCTCTG[A/G]
TAGTTCTTGAAGCTCGCTACAAACTCATCAGCCACAGTCCTCGTTTTCCTGATAGCTTCCAATCCTATATGCTCCCTCTACATGGTGAAATCATGGACTT

Reverse complement sequence

AAGTCCATGATTTCACCATGTAGAGGGAGCATATAGGATTGGAAGCTATCAGGAAAACGAGGACTGTGGCTGATGAGTTTGTAGCGAGCTTCAAGAACTA[T/C]
CAGAGAAGACAAAGCGCACGGCGAGATAGAGTCTCCAAAAACCCGACACCCGAATCGTGGCGAAGTTGCATCTTCGTCCTGAGTAGGGGTGGATTTGCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.00% 19.20% 20.33% 18.51% NA
All Indica  2759 32.40% 28.30% 25.34% 13.95% NA
All Japonica  1512 58.50% 1.10% 13.69% 26.65% NA
Aus  269 50.60% 31.20% 5.95% 12.27% NA
Indica I  595 30.90% 3.40% 51.26% 14.45% NA
Indica II  465 21.50% 54.60% 16.13% 7.74% NA
Indica III  913 40.30% 27.50% 15.44% 16.76% NA
Indica Intermediate  786 30.90% 32.40% 22.65% 13.99% NA
Temperate Japonica  767 76.50% 0.90% 2.74% 19.82% NA
Tropical Japonica  504 32.70% 1.40% 31.55% 34.33% NA
Japonica Intermediate  241 55.20% 1.20% 11.20% 32.37% NA
VI/Aromatic  96 24.00% 7.30% 27.08% 41.67% NA
Intermediate  90 50.00% 20.00% 14.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220914154 A -> DEL N N silent_mutation Average:41.251; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg1220914154 A -> G LOC_Os12g34540.1 downstream_gene_variant ; 3416.0bp to feature; MODIFIER silent_mutation Average:41.251; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg1220914154 A -> G LOC_Os12g34524-LOC_Os12g34540 intergenic_region ; MODIFIER silent_mutation Average:41.251; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220914154 NA 6.16E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 5.45E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 7.51E-06 mr1456 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 8.42E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 9.40E-10 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 2.00E-06 1.61E-07 mr1587 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 3.69E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 7.13E-06 mr1734 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 8.84E-06 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 1.91E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 9.20E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 1.47E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 2.55E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 3.29E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 3.33E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 5.73E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 4.88E-07 4.88E-07 mr1424_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 2.67E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 2.63E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220914154 NA 3.42E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251