\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220907449:

Variant ID: vg1220907449 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 20907449
Reference Allele: CAlternative Allele: A,CTT
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, C: 0.36, G: 0.02, others allele: 0.00, population size: 42. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAAGAAGAGCACTACCAAAATAACATGAGCGAAATGAAGTCTTACGAGGATCAACCTAATTAGTCAATATGTTATATATGACTGGGAGGCATCGGAAG[C/A,CTT]
ATTTGGGCTATACTCTGCCAAGGTCATTCCGTTTTCTTGTAGTGCTTGCGCTGCATATTGCAGCAACTAGTCTACAGCTGTAATATGCAACGCAAGCGGG

Reverse complement sequence

CCCGCTTGCGTTGCATATTACAGCTGTAGACTAGTTGCTGCAATATGCAGCGCAAGCACTACAAGAAAACGGAATGACCTTGGCAGAGTATAGCCCAAAT[G/T,AAG]
CTTCCGATGCCTCCCAGTCATATATAACATATTGACTAATTAGGTTGATCCTCGTAAGACTTCATTTCGCTCATGTTATTTTGGTAGTGCTCTTCTTAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 41.00% 0.70% 7.41% NA
All Indica  2759 50.10% 48.00% 0.72% 1.20% NA
All Japonica  1512 48.70% 32.80% 0.73% 17.72% NA
Aus  269 83.30% 5.90% 0.37% 10.41% NA
Indica I  595 6.40% 90.40% 0.34% 2.86% NA
Indica II  465 74.20% 25.60% 0.22% 0.00% NA
Indica III  913 64.70% 34.10% 0.99% 0.22% NA
Indica Intermediate  786 51.80% 45.40% 1.02% 1.78% NA
Temperate Japonica  767 75.60% 6.40% 0.78% 17.21% NA
Tropical Japonica  504 8.10% 77.00% 0.40% 14.48% NA
Japonica Intermediate  241 48.10% 24.50% 1.24% 26.14% NA
VI/Aromatic  96 15.60% 67.70% 0.00% 16.67% NA
Intermediate  90 55.60% 37.80% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220907449 C -> DEL N N silent_mutation Average:68.867; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg1220907449 C -> A LOC_Os12g34524-LOC_Os12g34540 intergenic_region ; MODIFIER silent_mutation Average:68.867; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg1220907449 C -> CTT LOC_Os12g34524-LOC_Os12g34540 intergenic_region ; MODIFIER N Average:68.867; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1220907449 C A -0.1 -0.03 -0.02 -0.04 -0.06 -0.05
vg1220907449 C CTT -0.25 0.07 0.03 -0.17 -0.18 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220907449 NA 2.61E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 1.12E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 4.59E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 2.05E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 2.21E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 3.25E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 7.95E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 9.10E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 8.19E-09 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 3.13E-08 NA mr1334 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 4.17E-09 2.98E-24 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 6.03E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 5.50E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 2.92E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 2.24E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 1.74E-06 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 3.65E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 1.06E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 1.57E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 1.18E-08 4.06E-29 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 3.92E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 9.57E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 1.96E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220907449 NA 9.66E-13 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251