\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220875140:

Variant ID: vg1220875140 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20875140
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAAGAGAGGCGATTGAGGAAGAAGATGGAGCTGACATGTGGTCCCACACTGGGGTGTGATGGTAATGGATGGAAAATGTGACGGCGGTGGCATGGATC[C/T]
AATTTTATAAAGTTCCAGTGGCACCTAACAGATATCGCAAACAGTAGTGGCATTTTTTTAATTTGACAAAATTGCAGTGGCATGGATCCAATTAACCCTA

Reverse complement sequence

TAGGGTTAATTGGATCCATGCCACTGCAATTTTGTCAAATTAAAAAAATGCCACTACTGTTTGCGATATCTGTTAGGTGCCACTGGAACTTTATAAAATT[G/A]
GATCCATGCCACCGCCGTCACATTTTCCATCCATTACCATCACACCCCAGTGTGGGACCACATGTCAGCTCCATCTTCTTCCTCAATCGCCTCTCTTCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.60% 22.00% 2.96% 52.50% NA
All Indica  2759 37.00% 2.90% 4.13% 55.96% NA
All Japonica  1512 0.80% 44.80% 0.40% 54.03% NA
Aus  269 4.50% 63.60% 5.58% 26.39% NA
Indica I  595 28.70% 1.50% 3.87% 65.88% NA
Indica II  465 39.40% 5.40% 4.30% 50.97% NA
Indica III  913 38.60% 1.80% 2.96% 56.74% NA
Indica Intermediate  786 40.10% 3.80% 5.60% 50.51% NA
Temperate Japonica  767 0.40% 74.20% 0.26% 25.16% NA
Tropical Japonica  504 1.20% 4.00% 0.40% 94.44% NA
Japonica Intermediate  241 1.20% 36.50% 0.83% 61.41% NA
VI/Aromatic  96 1.00% 84.40% 2.08% 12.50% NA
Intermediate  90 22.20% 33.30% 3.33% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220875140 C -> DEL N N silent_mutation Average:47.823; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1220875140 C -> T LOC_Os12g34460.2 downstream_gene_variant ; 4119.0bp to feature; MODIFIER silent_mutation Average:47.823; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1220875140 C -> T LOC_Os12g34470.1 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:47.823; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1220875140 C -> T LOC_Os12g34480.1 downstream_gene_variant ; 1712.0bp to feature; MODIFIER silent_mutation Average:47.823; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1220875140 C -> T LOC_Os12g34490.1 downstream_gene_variant ; 4420.0bp to feature; MODIFIER silent_mutation Average:47.823; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1220875140 C -> T LOC_Os12g34470-LOC_Os12g34480 intergenic_region ; MODIFIER silent_mutation Average:47.823; most accessible tissue: Minghui63 root, score: 77.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220875140 NA 4.72E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 1.12E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 2.09E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 5.67E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 1.06E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 9.59E-11 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 1.06E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 5.12E-07 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 1.46E-15 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 3.90E-07 9.61E-10 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 1.10E-09 2.03E-25 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 3.21E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 5.63E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 3.38E-12 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 3.38E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 3.01E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 1.63E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 1.39E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 8.50E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 3.76E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 5.13E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 2.25E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 1.88E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 5.13E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 6.51E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 1.10E-07 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 1.57E-20 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 7.75E-11 2.60E-12 mr1334_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 3.18E-09 1.06E-30 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 2.27E-21 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 NA 6.52E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 4.73E-06 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220875140 9.28E-06 1.09E-12 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251